ID: 1124662056

View in Genome Browser
Species Human (GRCh38)
Location 15:31557907-31557929
Sequence ACTCCTGGGATGACACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124662049_1124662056 9 Left 1124662049 15:31557875-31557897 CCCTAACAGTGCATTGCTGGCTG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 132
1124662050_1124662056 8 Left 1124662050 15:31557876-31557898 CCTAACAGTGCATTGCTGGCTGC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 132
1124662047_1124662056 26 Left 1124662047 15:31557858-31557880 CCGAGAAAAGCTCTACTCCCTAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124662056 Original CRISPR ACTCCTGGGATGACACATCT GGG Intronic
901863893 1:12091453-12091475 GCTCCTGGGGTGGTACATCTTGG + Intronic
904522698 1:31107994-31108016 ACTCCTGGGATCAGACATTTGGG + Intergenic
906110749 1:43320452-43320474 AGTGCTGGGATTACACATGTGGG - Intronic
907938166 1:59061288-59061310 ACTCCAGGGACCACTCATCTGGG - Intergenic
909713947 1:78684293-78684315 ACAGCTGGGATGACAGGTCTGGG + Intergenic
909933795 1:81528288-81528310 ACTCATGGGATCACTCATTTTGG - Intronic
910860983 1:91742114-91742136 ACTCCTGGGAGGACACAGAACGG - Intronic
913050622 1:115114079-115114101 ACTTCTGGGATGAGACAGCCTGG + Intergenic
913085262 1:115430961-115430983 ACTCCTGGGATGAAAGAGCAAGG + Intergenic
913234226 1:116766207-116766229 ATTCCTGGGAGCACACATTTAGG + Intronic
915202192 1:154239321-154239343 GCTCCTGGTATGATACATCCAGG + Intronic
918321961 1:183373021-183373043 GCTGCAGGGATGAGACATCTGGG - Intronic
920432482 1:205927833-205927855 AGGCCTGGCATGACATATCTTGG - Intronic
922785479 1:228280441-228280463 ACTCGTGGGATGACTCACCTCGG - Exonic
924031470 1:239889701-239889723 AGTCCTGGGCTGCCACACCTGGG + Intronic
924257148 1:242193765-242193787 ACTCCTGGGGTCACAGATTTGGG - Intronic
1068318781 10:55382713-55382735 TCTACTGGAATGACTCATCTTGG + Intronic
1069822930 10:71238718-71238740 AGTGCTGGGATTACACACCTGGG + Intronic
1071104751 10:82081230-82081252 ACTCTTGGAATGTCAGATCTTGG - Intronic
1071455949 10:85851814-85851836 ACTCCTTAGATGACTGATCTTGG + Intronic
1072455673 10:95573663-95573685 ATTCCAGGGATGACTCATCATGG - Intergenic
1075651678 10:124131605-124131627 ACTCCTCGGAGGACACACATAGG - Intergenic
1076841317 10:133047276-133047298 ACGCCTGGGAGGACACGTCGGGG - Intergenic
1080663879 11:34318897-34318919 AGCCCTGAGATGACACTTCTTGG - Intronic
1082129969 11:48476635-48476657 ACTCCTAGGAGAAAACATCTTGG - Intergenic
1086872779 11:92059157-92059179 ACTCCTGGGTTGAATTATCTAGG + Intergenic
1090460640 11:126888616-126888638 AATCCTGAAATGATACATCTTGG - Intronic
1090731395 11:129575752-129575774 ACTTCTTGGATGACTCAACTGGG - Intergenic
1091927663 12:4369115-4369137 TCTCCTAGGCTGACACATCTGGG - Exonic
1094610495 12:31990929-31990951 AGTGCTGGGATGACACACATGGG - Intronic
1095394104 12:41742956-41742978 ACTGCTGGAATGACAGCTCTTGG - Intergenic
1098266119 12:68721857-68721879 ACACCTGGGAAGACACAGTTTGG + Exonic
1099841947 12:87977126-87977148 ACTGCTGGGATGACAGAGATGGG - Intergenic
1104709054 12:130972465-130972487 ACATGTGGGAGGACACATCTTGG + Intronic
1107241732 13:38243471-38243493 ACTCCTGGGGTTACAGATGTGGG - Intergenic
1108454543 13:50599659-50599681 ACTCCTGGGATGCCCAGTCTGGG + Intronic
1108940309 13:55944777-55944799 ACTCCTGGGAGGAAACACTTTGG - Intergenic
1111013114 13:82338276-82338298 ATTCCTGGAATGATACATTTTGG - Intergenic
1111083114 13:83337923-83337945 ACTCCTTGGAAGTCACATCATGG - Intergenic
1114385640 14:22251561-22251583 ACTCCTGTGATCACCCACCTCGG + Intergenic
1116060618 14:39920290-39920312 ACTCCTGGGATACCAAAGCTGGG - Intergenic
1117787079 14:59297175-59297197 ACTCCTGGCATGGCACAGCCAGG + Intronic
1118824082 14:69364770-69364792 ACTCCTGGGGTGGGAAATCTGGG - Intergenic
1121028433 14:90634909-90634931 ACTTTTGCTATGACACATCTAGG - Intronic
1122280063 14:100616732-100616754 ACTCCTGGGAGGTGACCTCTAGG + Intergenic
1123133599 14:106007672-106007694 ACTCCTGGAAGGACAGATCTTGG + Intergenic
1123583623 15:21738118-21738140 ACTCCTGGAAGGACAGATCTTGG + Intergenic
1123620273 15:22180721-22180743 ACTCCTGGAAGGACAGATCTTGG + Intergenic
1123980534 15:25597850-25597872 CCTCCTGAGATAACATATCTGGG + Intergenic
1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG + Intronic
1126759126 15:51953356-51953378 AGTGCTGGGATTACACATGTGGG - Intronic
1133656356 16:7868310-7868332 AGTCCAGGCATGACACAGCTGGG - Intergenic
1135125211 16:19803910-19803932 AGTGCTGGGATGACAAATGTGGG + Intronic
1135967754 16:27050141-27050163 ACACCTGGGCTGAGACAGCTGGG - Intergenic
1136236347 16:28916063-28916085 ACTCCTGAGACCACCCATCTAGG + Intronic
1138338070 16:56268437-56268459 TCTCCTGGAGTGACACATTTGGG - Intronic
1138381711 16:56607441-56607463 ACTCCTAGCATGACACACTTCGG + Intergenic
1141922554 16:87145774-87145796 GCTCCTGGGGTGTCACCTCTAGG + Intronic
1142574200 17:895433-895455 ACTGCTGCCATGACACAGCTGGG + Intronic
1144844888 17:18211888-18211910 ACTCCTGGGCTCATCCATCTTGG - Intergenic
1148765168 17:50034638-50034660 ACACCTGGGCTGACACAGTTCGG + Intergenic
1148814592 17:50318485-50318507 AGACTTGGGATGGCACATCTGGG + Intergenic
1156486640 18:37470538-37470560 GCTGCTGGGATGCCACATTTGGG - Intronic
1157643234 18:49239573-49239595 ACTCTTGGGATGTCCCCTCTTGG + Intronic
1158624821 18:59061995-59062017 GCTCCTTGGAAGACAGATCTGGG + Intergenic
1158873782 18:61713410-61713432 ACTTCTGGGAATAAACATCTGGG + Intergenic
1161171883 19:2816222-2816244 GCTCCTGAGATGCCCCATCTGGG - Intergenic
1162006704 19:7785539-7785561 AGTGCTGGGATTACACATGTGGG + Intergenic
1163189810 19:15669534-15669556 GTCCCTGGGATGAGACATCTTGG - Intergenic
1163362046 19:16852886-16852908 ACCCCTGAGATGACACCTCTGGG - Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166608448 19:44166369-44166391 ACTCCTGGGATTACAGGTGTTGG - Intronic
926210748 2:10867861-10867883 TCTCCTGAGATGCCACCTCTTGG + Intergenic
932131418 2:69190779-69190801 TCTCCTGGTATTATACATCTAGG + Intronic
932273032 2:70427736-70427758 AGTGCTGGGATTACACATGTAGG - Intergenic
933805308 2:85994825-85994847 ACTCCTCAGATTTCACATCTGGG - Intergenic
936643123 2:114338131-114338153 ACTCTTGTGATGCCAAATCTAGG - Intergenic
936889321 2:117350640-117350662 CCTCCTGTGATGACAGATGTTGG + Intergenic
938378499 2:130823781-130823803 ACACCTGGGACGGTACATCTGGG + Intergenic
944994490 2:205278237-205278259 ACTTCCTGGATGACACCTCTGGG + Intronic
946080298 2:217112889-217112911 GCTCCTGAGATGAGACACCTAGG + Intergenic
946102798 2:217341233-217341255 AATGCTGGGATTACACATGTGGG + Intronic
948481739 2:238254593-238254615 GCTCCTGGGATGTCATGTCTGGG + Intronic
948796423 2:240404709-240404731 ACTCCTGGGATTACAGGTGTGGG - Intergenic
1169720202 20:8667873-8667895 TCTGCTGGGAGGTCACATCTAGG - Intronic
1172514064 20:35521075-35521097 ATTACTGGGATGACAAATATTGG - Intergenic
1173607733 20:44343533-44343555 GCCCCTGGGATAACACATCCTGG + Intronic
1179149582 21:38798527-38798549 ACTCCTGGGAAGACCCTTCTAGG + Intergenic
1179404472 21:41113817-41113839 GCTCCGGAGAGGACACATCTTGG - Intergenic
1182715264 22:32352973-32352995 CCTCCTGGCATGAAACAACTGGG + Intergenic
1182862430 22:33571580-33571602 ACTCCTGGAAATCCACATCTTGG - Intronic
1185308475 22:50137946-50137968 ATTCCTGGGATGAACCCTCTTGG - Intronic
949755432 3:7404636-7404658 ATTCCAGGGAGCACACATCTTGG - Intronic
950371702 3:12536437-12536459 ACTCCCCGGAGCACACATCTGGG - Intronic
954031854 3:47825289-47825311 ACTCCTGGGATGGCAGAGCTAGG + Intronic
955051089 3:55411723-55411745 ACTCCAGCAATCACACATCTTGG - Intergenic
955349030 3:58180484-58180506 ACTCCTAGGATGACATGACTGGG - Intergenic
956021044 3:64933625-64933647 ACTCCTGGCATGAAAAATATTGG - Intergenic
963659700 3:148109703-148109725 ACTCCTGGGCTCACGCAACTAGG - Intergenic
971403996 4:26303341-26303363 ACTCCTGGGATTACAGATGTAGG - Intronic
973230151 4:47831504-47831526 ACACATGGGATGACTCACCTTGG - Intronic
975635436 4:76443566-76443588 ACTCCTGGGATGAACCAAGTGGG - Intronic
976439925 4:85061426-85061448 ACTCCTGTGATGACACAGCCTGG - Intergenic
976663129 4:87561294-87561316 AATCTTGAGATGAAACATCTTGG + Intergenic
979628473 4:122873182-122873204 ACTCCTGGCTTTCCACATCTTGG + Intronic
981124555 4:141091014-141091036 ACACCTGGAATATCACATCTGGG + Intronic
981718949 4:147779509-147779531 ACTCCTGAGATAATCCATCTGGG - Intronic
982068111 4:151672459-151672481 ACACCTGGGAGGTCACAGCTTGG + Intronic
984460448 4:180029796-180029818 ACTCCTGAAATGTCATATCTAGG + Intergenic
986490864 5:8288517-8288539 ACTCATGGCATGTCAAATCTGGG + Intergenic
987008108 5:13731867-13731889 AGTCCTGGGATGACAGATGTGGG - Intronic
987459876 5:18196187-18196209 ACTCATGGGATGAATCATGTAGG + Intergenic
988809861 5:34774086-34774108 ACTGCTGGGATTACAGATGTGGG - Intronic
990529735 5:56661238-56661260 ACTCCTGGAAGGAGACATTTGGG - Intergenic
996880005 5:128286083-128286105 TCTTCTGGGATAACAGATCTTGG + Intronic
996997767 5:129719774-129719796 AGTCCTGGGATTACAGATGTGGG - Intronic
1005470755 6:26160007-26160029 ACTCTTGAGATGACAGATTTAGG - Intronic
1005944605 6:30586190-30586212 CCTCCTGGGATTCCTCATCTTGG - Exonic
1007787857 6:44291707-44291729 TCTCCTGGGATGTCACAGCTGGG - Intronic
1013623950 6:111918912-111918934 ACTCCTGGACTCACACATCTGGG - Intergenic
1018617865 6:165704961-165704983 ACTCCTGGGAGGACACAACAGGG - Intronic
1019772725 7:2893820-2893842 TCACATGGGATGGCACATCTGGG + Intergenic
1022111245 7:27233506-27233528 GCTCCTGGCATGACACTGCTAGG + Intergenic
1024619741 7:51147135-51147157 AGTCCAGGGCTGACACAGCTTGG - Intronic
1026983057 7:74537874-74537896 TCTCCTGGGGTGAACCATCTGGG - Intronic
1028651358 7:93153443-93153465 ACTCCTGGGAATAAACAGCTGGG + Intergenic
1029298814 7:99562349-99562371 ACTCCTGAAATAACACATCCTGG - Intronic
1033831100 7:145254376-145254398 ACTTCTGGGCTGTGACATCTAGG - Intergenic
1038567370 8:28631006-28631028 ACACCTGAGATGAGACATTTTGG + Intronic
1038920103 8:32073632-32073654 CCTCCTGGGAAAACATATCTAGG + Intronic
1039055242 8:33531075-33531097 TCTCGGTGGATGACACATCTAGG + Intergenic
1039078097 8:33710505-33710527 ACTCCTGGGATCACAGCTCAAGG - Intergenic
1044535549 8:93353050-93353072 TCTCATGTGGTGACACATCTTGG - Intergenic
1044713660 8:95080874-95080896 AATCCTGGGATAACACAGCTTGG - Intronic
1045343545 8:101274682-101274704 AGTCCTGGCATGGCACAGCTAGG + Intergenic
1050065836 9:1758652-1758674 ACTTCTCAGAAGACACATCTTGG - Intergenic
1052189971 9:25648853-25648875 ACCCCTGCGATGACATATCATGG + Intergenic
1057180048 9:93024870-93024892 ACTTGTGGGAAGACACAGCTTGG + Intronic
1057916425 9:99059113-99059135 ATTACTGGGATGACAAATCCTGG - Intronic
1060205034 9:121677557-121677579 TCTCCTGGGATGCCACACTTGGG - Intronic
1188984700 X:36758757-36758779 ACTCCTGGCAGCACACTTCTAGG + Intergenic
1190322748 X:49188140-49188162 ACTCCCGTGATGAAACAGCTAGG - Exonic
1190648226 X:52543432-52543454 ACTTCTGGGAGGACTGATCTGGG - Intergenic
1191995357 X:67089388-67089410 ACTGCTGGGATGCACCATCTAGG - Intergenic
1193296317 X:79836078-79836100 ACTCCAGGGGTCACACTTCTGGG - Intergenic
1195852528 X:109298512-109298534 ACTCCTGTGATGTCAAATGTAGG + Intergenic
1196209950 X:112985033-112985055 ACTCCTGGATTGACATAACTCGG + Intergenic
1198318829 X:135498221-135498243 CAGGCTGGGATGACACATCTTGG - Intergenic
1201583922 Y:15539588-15539610 ACTCTTTGGCTGACAAATCTAGG - Intergenic