ID: 1124665132

View in Genome Browser
Species Human (GRCh38)
Location 15:31585865-31585887
Sequence ATCAATAGAGAGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2262
Summary {0: 1, 1: 0, 2: 7, 3: 240, 4: 2014}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124665128_1124665132 -6 Left 1124665128 15:31585848-31585870 CCGGGAGTTGTAATGACATCAAT 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1124665132 15:31585865-31585887 ATCAATAGAGAGAGGAAGGAGGG 0: 1
1: 0
2: 7
3: 240
4: 2014

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124665132 Original CRISPR ATCAATAGAGAGAGGAAGGA GGG Intronic
Too many off-targets to display for this crispr