ID: 1124667581

View in Genome Browser
Species Human (GRCh38)
Location 15:31606726-31606748
Sequence TTTAATGCCTAGAGGGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124667581 Original CRISPR TTTAATGCCTAGAGGGTATC TGG (reversed) Intronic
902564796 1:17304397-17304419 CCAAATGCCTAGAGGGTATTTGG + Intergenic
908280631 1:62530958-62530980 TTTACTGACTAGTGGGTATAGGG + Intronic
908489272 1:64626729-64626751 CATAATGCCTAGAGGGTCACAGG + Intronic
912567319 1:110597423-110597445 TTTCATGCCTAGAGGTTGTAAGG + Intronic
917747323 1:178023266-178023288 TTTAATGGCTATAGAGTTTCAGG + Intergenic
921007491 1:211109094-211109116 TTGAATGCCTAAAAGGTAACTGG + Intronic
1064127589 10:12677055-12677077 TTTCATGCCTTGGGGGTACCAGG - Intronic
1068154231 10:53176045-53176067 TTAAATGCCTAGAAGATAACAGG + Intergenic
1072020186 10:91391533-91391555 TTGAATGCCTACTGGGTATCAGG + Intergenic
1075320681 10:121489510-121489532 ATTAATGCCTTGAGGATATATGG - Intronic
1076371293 10:129956972-129956994 CTTTATGCCTAGAGAGTTTCTGG - Intronic
1078396089 11:10983342-10983364 TTGAATGCAGAGAGAGTATCAGG + Intergenic
1079097793 11:17522143-17522165 TTAAATGCCTAAAAGGTATTTGG + Intronic
1080210777 11:29782359-29782381 TTTCTAGCCTAGAGAGTATCTGG - Intergenic
1085012259 11:73149376-73149398 TTGAATGCTTAGGGGGTACCAGG + Intergenic
1085447550 11:76610803-76610825 CTTAATGCTTGGAGGGGATCAGG + Intergenic
1085838640 11:79983872-79983894 ACTAATGCCTAGAGGGGTTCAGG + Intergenic
1088694962 11:112358810-112358832 TTCAATGCCTATAGGGTCCCAGG - Intergenic
1092000106 12:5024792-5024814 ATTAATGCTTAGAGGTCATCTGG - Intergenic
1097978765 12:65715554-65715576 TTTAAGGCCTACAGTGTATTTGG - Intergenic
1098114432 12:67160147-67160169 TTGAATACCTAGAACGTATCAGG - Intergenic
1098558337 12:71844458-71844480 TTTAATTAGTAGAGGGTATAGGG - Intronic
1102983596 12:117261623-117261645 TTTAGTGCCTGTTGGGTATCAGG - Intronic
1107417492 13:40214034-40214056 TATAATGGCTAGAGGGTAGTAGG - Intergenic
1108161221 13:47641931-47641953 TTCAATGCCTAGAATGTGTCAGG + Intergenic
1109856911 13:68142325-68142347 TTAAATTCAGAGAGGGTATCAGG + Intergenic
1111050225 13:82873092-82873114 TTTGATGCCTAGTGGGTTTAAGG + Intergenic
1114997522 14:28375183-28375205 TTGAATGCCTAGAAGGTGTTGGG + Intergenic
1116805079 14:49486174-49486196 TTTAATGCCTGGTGGGAAGCAGG - Intergenic
1120831915 14:89005010-89005032 CTGAATGCCTACAGTGTATCAGG + Intergenic
1121934070 14:98000586-98000608 TTTAATGAACAGATGGTATCCGG - Intergenic
1124057914 15:26259921-26259943 TTTAATGCCTGGAATGCATCAGG - Intergenic
1124667581 15:31606726-31606748 TTTAATGCCTAGAGGGTATCTGG - Intronic
1128828297 15:70741894-70741916 TTTAATGCATGGAGGCTATCAGG - Intronic
1131938710 15:97536708-97536730 TTCAATACCTAGAGGGGAACAGG + Intergenic
1135550791 16:23396749-23396771 TTTCATCAGTAGAGGGTATCAGG + Intronic
1138011864 16:53388807-53388829 GTGAATGCCTGGAGAGTATCAGG + Intergenic
1138213122 16:55179838-55179860 TTTACTGTCTAGAGGGTAAGTGG + Intergenic
1138939160 16:61768953-61768975 TTTAATGCATAAAGGGTTTTGGG - Intronic
1140276736 16:73515704-73515726 ATTTATGGCTAGAGGGAATCTGG + Intergenic
1142258301 16:89026901-89026923 TTTAATACCTACAGGGTCTGTGG + Intergenic
1149941349 17:60871109-60871131 TTTAATGACTGTAGGTTATCTGG + Intronic
1149979456 17:61298250-61298272 TTTTATGCCTAGTGTGTAACAGG + Intronic
1152501682 17:80715265-80715287 TTTAATGCTTATAGGATATGTGG - Intronic
1157126277 18:44959466-44959488 TTTAATGCCTAGTATGTATAAGG + Intronic
1158256736 18:55559080-55559102 TTGAATGCCTAGTGGGTGTATGG - Intronic
1163054682 19:14709475-14709497 TTTCATGACTAGGGGGTATGTGG - Intronic
932586157 2:73030612-73030634 TTTAATGGGTAGAGAGTTTCAGG - Intronic
939585581 2:144000400-144000422 TTTCATGCCTAGAGTGTTTGGGG - Intronic
943940133 2:193982926-193982948 TTTAACGCCTAGAAGGAAACAGG + Intergenic
944514985 2:200503688-200503710 TTAAATTCCTAAAGGGGATCTGG + Intronic
944520280 2:200558739-200558761 TTTAATGTTTAGAAGTTATCTGG + Intronic
945751804 2:213795906-213795928 TATAATGAATAGAGGCTATCTGG - Intronic
1168937141 20:1675088-1675110 TTTTATGGCTACAGGGTATCTGG - Intergenic
1169362017 20:4958351-4958373 TTTAAAGCCTAGAGGGGAGGGGG + Intronic
1169694202 20:8369074-8369096 TTGAATGCCTACAATGTATCAGG - Intronic
1170100967 20:12699010-12699032 TTTCATGCCTAGAGGTTGTGGGG + Intergenic
1170534758 20:17329206-17329228 TTTAATGACTCGAGGGTTTTTGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175802601 20:61809683-61809705 TTTAATGCCAGGAGGGGTTCCGG + Intronic
1177898726 21:26886933-26886955 CTTAATACCTAGAGAGTTTCAGG - Intergenic
1183919097 22:41149799-41149821 TATAATGCCTCCAGGGTCTCAGG + Exonic
953005922 3:38979176-38979198 TTAAATGCCTACAGTGTGTCAGG - Intergenic
956277292 3:67516314-67516336 TTTAAAACCTAGAGTGTTTCAGG + Intronic
957959780 3:87234470-87234492 TTTAATGCCCAGAGTGGAGCCGG + Intronic
958939896 3:100299810-100299832 TATAATGCCAAAAGGGTATCTGG - Intronic
961855338 3:129864835-129864857 TTTAATGCCAAAAGGTTATTTGG + Intronic
964230642 3:154463192-154463214 TTTAATGCCTAAATATTATCAGG - Intergenic
964427989 3:156573233-156573255 GTTAAAGCCTAGAGGGTCCCAGG - Intergenic
964825445 3:160822030-160822052 TTTTAGGCCTAGAGGGTATATGG - Intronic
966271845 3:178117363-178117385 TTAATTGCCTAGAGGGTTCCAGG - Intergenic
969281837 4:6176050-6176072 TTTAATGCCTGGGAAGTATCTGG - Intronic
969623276 4:8289675-8289697 TTTAATGCCTAGGGGCTAGGAGG - Intronic
971476775 4:27080113-27080135 TTTAATGCCCAGAAGGCAGCTGG - Intergenic
972315807 4:37924499-37924521 TTTAATGGCTACAGAGTTTCTGG - Intronic
974310416 4:60201040-60201062 CTTAATGCCTAGAGCTCATCTGG + Intergenic
976143162 4:82014408-82014430 TTTACTGCCTTGAGAGTTTCTGG + Intronic
977215959 4:94283946-94283968 TTTACTTCCTAAAGGGTAACAGG - Intronic
978863022 4:113473608-113473630 TTTAATTACTAGAGGCTTTCAGG + Intronic
980061857 4:128139312-128139334 TTTAATGCCTAGACTGTTACTGG - Intronic
980927654 4:139154371-139154393 TTTAATGCTTATAGTGTGTCAGG - Intronic
982188748 4:152831568-152831590 TGTATTGCCTAGAGGGCATAAGG - Intronic
983415856 4:167453442-167453464 TTTAATGTCTATAGGGAATGAGG + Intergenic
985144990 4:186887113-186887135 TTTAATGCCTGAATGGTGTCTGG - Intergenic
985380307 4:189387806-189387828 TTTAATGCCTAGAAAGTAGGAGG - Intergenic
990648709 5:57873962-57873984 TTTCAAGGATAGAGGGTATCAGG + Intergenic
992852533 5:80824838-80824860 TTTAATGACTGCAGTGTATCTGG + Intronic
992998348 5:82354839-82354861 TTTAATGACTACACGGTACCAGG - Intronic
999083692 5:148868130-148868152 TCTCAGGCCTAGAGGGCATCGGG - Intergenic
1012919917 6:105210676-105210698 AATAATGCTTTGAGGGTATCTGG + Intergenic
1017369236 6:153685237-153685259 TTTAATGTCTGTAGGATATCTGG + Intergenic
1018665308 6:166130852-166130874 TTTAATGTCTATAGGGACTCTGG - Intergenic
1018914307 6:168123451-168123473 TTTAATCCCTTGAGTGAATCAGG - Intergenic
1024166899 7:46743254-46743276 TTTAATGTCTGCAGAGTATCTGG + Intronic
1024847346 7:53662346-53662368 TTTAATGACTAGAGAATTTCAGG - Intergenic
1030250341 7:107436470-107436492 TTTAATGACTACAGAGTTTCAGG + Intronic
1030789896 7:113711079-113711101 TTTAATGCTTAGATGCTGTCAGG + Intergenic
1032277416 7:130471310-130471332 TTTAATGCCTATAGGTACTCTGG - Intergenic
1039616270 8:38957125-38957147 TTCATTTCCTAGAGGGTCTCAGG - Intronic
1043744219 8:83853377-83853399 TTTAATTCCTAGAAGGTTTTTGG + Intergenic
1051316160 9:15835173-15835195 TTTATTCCCTAGAGGGAAACAGG + Intronic
1052613157 9:30801726-30801748 TTTAATGTCTATAGGATTTCAGG + Intergenic
1058419144 9:104818235-104818257 TTTCATGCCCAGAGTGTCTCTGG + Intronic
1061459629 9:130726425-130726447 TTTAATGTCTATAGGGTCTGTGG + Intronic
1186307836 X:8283360-8283382 TTTAAGGCCTTGAGGGAATATGG + Intergenic
1193273140 X:79552550-79552572 TTTAATGACTATAAGGTTTCAGG + Intergenic
1194433699 X:93843383-93843405 TTTAATGACCATAAGGTATCAGG - Intergenic
1197072053 X:122311333-122311355 TTTAATGCCTATAGTGTACCAGG + Intergenic