ID: 1124676006

View in Genome Browser
Species Human (GRCh38)
Location 15:31686345-31686367
Sequence AGAGAGCTCAGGTTTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124676004_1124676006 4 Left 1124676004 15:31686318-31686340 CCATGAGCGTGGAGCTCACTCAA 0: 1
1: 1
2: 0
3: 8
4: 68
Right 1124676006 15:31686345-31686367 AGAGAGCTCAGGTTTCCAAGTGG 0: 2
1: 0
2: 0
3: 9
4: 192
1124676000_1124676006 28 Left 1124676000 15:31686294-31686316 CCATTTGGTTCTCCAGCACACAG 0: 2
1: 0
2: 2
3: 25
4: 193
Right 1124676006 15:31686345-31686367 AGAGAGCTCAGGTTTCCAAGTGG 0: 2
1: 0
2: 0
3: 9
4: 192
1124676002_1124676006 16 Left 1124676002 15:31686306-31686328 CCAGCACACAGGCCATGAGCGTG 0: 1
1: 1
2: 1
3: 13
4: 117
Right 1124676006 15:31686345-31686367 AGAGAGCTCAGGTTTCCAAGTGG 0: 2
1: 0
2: 0
3: 9
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124676006 Original CRISPR AGAGAGCTCAGGTTTCCAAG TGG Intronic