ID: 1124676720

View in Genome Browser
Species Human (GRCh38)
Location 15:31693530-31693552
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 2, 1: 0, 2: 1, 3: 36, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124676718_1124676720 -10 Left 1124676718 15:31693517-31693539 CCTGTATTCTGGCTCTGAAATGC 0: 2
1: 0
2: 1
3: 22
4: 232
Right 1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG 0: 2
1: 0
2: 1
3: 36
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901668355 1:10839090-10839112 TGTGCAAAGCTGAATGTGGCAGG + Intergenic
901741237 1:11343344-11343366 GCTGAATGGCAGAATGTGACAGG - Intergenic
901819210 1:11815689-11815711 TTCAAAATGCAGAATCTGGCTGG - Intronic
902460861 1:16575563-16575585 TTTGAAATGCAAACTGTGACAGG - Intronic
903843390 1:26261085-26261107 TCAGAAATGCAGAATCCAGCTGG - Intronic
906394412 1:45448926-45448948 GTTGAAATGCAAAATGGGGCAGG + Intronic
906465363 1:46073967-46073989 TATTAAATGCAGAATGTGTTTGG + Intronic
906637444 1:47418638-47418660 TTAGAAATGCAGAATCTGGCAGG + Intergenic
911345338 1:96690115-96690137 TCAGAAATTCAGAATTTGTCAGG - Intergenic
911904720 1:103552240-103552262 GCTGAAATGGGGAATGTGTCTGG + Intronic
912389179 1:109290116-109290138 CCTTCAATGCAGAATATGGCTGG + Intergenic
913432125 1:118806941-118806963 TCTAAAAAGCAGATTGTGACTGG - Intergenic
914083979 1:144436187-144436209 TTTGAAATGCAAACTGTGACGGG - Intronic
914365760 1:146976573-146976595 TTTGAAATGCAAACTGTGACAGG + Intronic
914486684 1:148116869-148116891 TTTGAAATGCAAACTGTGACAGG - Intronic
915966533 1:160313707-160313729 TAAGAAATGCGGAATGAGGCCGG - Intronic
918379379 1:183939037-183939059 TCTGAAAACAAGAAGGTGGCCGG + Exonic
918582942 1:186153661-186153683 TATGAAATGCAGAATGAGCGGGG - Intronic
919260462 1:195186880-195186902 TCTTAAATGTAAAATGTGTCAGG - Intergenic
919747624 1:201018308-201018330 TAAGAAAGGGAGAATGTGGCTGG + Intronic
920436743 1:205951821-205951843 TGTGGAATGGAGAATGAGGCCGG + Intergenic
921508825 1:216007316-216007338 TCTGTAAAACAGAATGTGACTGG + Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922595620 1:226810662-226810684 TGAGAAATGCAGAATGTGATGGG + Intergenic
923020210 1:230157620-230157642 GGTGGAATGCAGCATGTGGCGGG + Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
923705010 1:236336893-236336915 TCAGAAAGGCAGGAAGTGGCTGG + Intergenic
1063203585 10:3809444-3809466 TCTGAAATGCACAAGCTTGCAGG + Intergenic
1063373683 10:5538814-5538836 TCTGAGACGCAGAATGTACCTGG - Intergenic
1063648856 10:7913321-7913343 TTTGAAATGCAGGATGTGCCTGG + Intronic
1063802543 10:9596485-9596507 TCTGAAATGCCGAAGAAGGCAGG + Intergenic
1064718790 10:18206563-18206585 TCTGAAAGCCAGAGAGTGGCTGG - Intronic
1065305339 10:24363330-24363352 TTTGAAAGGCTAAATGTGGCAGG - Intronic
1068183162 10:53548483-53548505 TCTGACATGCAGAATGTCTCTGG + Intergenic
1069144613 10:64874561-64874583 TCTGGAATGCACAATGTCCCTGG + Intergenic
1069512018 10:69049652-69049674 TTTGAAATGCAGTATGTGACCGG + Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072576381 10:96704419-96704441 TTAGAAATGCAGAATCTGGCTGG + Intronic
1072988329 10:100164496-100164518 TTTGACATGCAGAATGAAGCTGG + Intronic
1073139731 10:101239112-101239134 TTCGAAATGCAGGGTGTGGCAGG - Intergenic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1074930791 10:118123713-118123735 TCTGAAATTCAGATGTTGGCTGG - Intergenic
1075381379 10:122021532-122021554 TTGGAAATTCAGAGTGTGGCTGG - Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1076438148 10:130460295-130460317 TCTGACACACAGAATGGGGCCGG + Intergenic
1076498692 10:130917121-130917143 GCTGAAATGCAGGTGGTGGCAGG - Intergenic
1078152738 11:8773179-8773201 CCTTAAATGGAGAATGTGCCTGG + Intronic
1078721260 11:13885279-13885301 TCAACAATGCAGAATTTGGCAGG - Intergenic
1079007859 11:16804770-16804792 TCTGAAGAGCAGAATTTGGCTGG - Intronic
1079329491 11:19521922-19521944 TCTGAGAGGCAGAATTTGGCAGG + Intronic
1080120725 11:28674153-28674175 TTTTGAATGCAGAATCTGGCAGG - Intergenic
1080322337 11:31025999-31026021 TGTAAAATGCAGAAAGTGCCAGG + Intronic
1080543297 11:33290562-33290584 TCTGATATGCAGAATAATGCAGG - Intronic
1080597660 11:33788939-33788961 TAAGAAATGTACAATGTGGCTGG + Intergenic
1080849254 11:36054132-36054154 TCTGAAATGCAGAAAATGGGGGG - Intronic
1081073741 11:38642587-38642609 TCTGAAAGGAAGAATAAGGCAGG - Intergenic
1083027809 11:59565291-59565313 TCTGAAATTCAAATTTTGGCCGG + Intergenic
1083228245 11:61298328-61298350 TCAGAAAGACAGAATGTGGTGGG - Intergenic
1084422622 11:69067913-69067935 TCTGAGAAGCTGAAAGTGGCTGG + Intronic
1086285813 11:85249584-85249606 ACTGAAATGAAGAAAGAGGCAGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1089315014 11:117585698-117585720 ACTGCAATGCAGGATGTAGCTGG + Intronic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089937291 11:122377329-122377351 GCTGAAATGCTGAAGGAGGCGGG + Intergenic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1090667698 11:128925624-128925646 TATGAAAATCAGATTGTGGCCGG + Intergenic
1091805440 12:3352716-3352738 TCTGCAATGCTGAATGAGGAGGG - Intergenic
1091890519 12:4050295-4050317 TGTGAATTGCAGATTGTGGGAGG - Intergenic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1092103350 12:5903519-5903541 GCTGAAATTCAGATTCTGGCTGG + Intronic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1094717523 12:33027930-33027952 ACTAAAAGGCAGAGTGTGGCAGG + Intergenic
1095202542 12:39401096-39401118 TCTGAAATGCAGACTCTGTGAGG - Intronic
1095800620 12:46267849-46267871 TCTAAAATGCAGAGGGTGGCAGG - Intronic
1096454000 12:51770367-51770389 TCAGAAATGGAGAGGGTGGCAGG - Intronic
1096666694 12:53171015-53171037 TTAGAAATGCAGAATCTGGCCGG - Intronic
1096933357 12:55241478-55241500 TTTGAAATGCAGATTATGACTGG - Intergenic
1097095328 12:56543167-56543189 TTTGAAATGAAGTATGGGGCTGG - Intronic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1100592919 12:96045892-96045914 TCAGAAATGCAGATCTTGGCCGG + Intergenic
1100716271 12:97309359-97309381 TCTAAAATGCAGGATCTGACCGG + Intergenic
1102067500 12:109989528-109989550 TTAGAAATGCAGAATGGGGTGGG - Intronic
1102537606 12:113592842-113592864 TTTGAAAAGCACAATATGGCCGG + Intergenic
1103086976 12:118069057-118069079 TCTGAAATGCAAAGTCTGGCTGG - Intronic
1103672971 12:122633279-122633301 TTAGAAATGCAGAATCTGGCTGG - Intergenic
1103843707 12:123886884-123886906 TGTAAACTGCAGTATGTGGCTGG + Intronic
1104148143 12:126055315-126055337 ACAGAAATGCAGAATGGGGCAGG - Intergenic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105947226 13:25200536-25200558 TATGAAAAGCAGAATAGGGCCGG - Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1107834708 13:44404188-44404210 TTTGAAATGCAGAATATGCCAGG + Intergenic
1107910878 13:45104896-45104918 TTTAAAATGCAGATTCTGGCCGG + Intergenic
1109347736 13:61136180-61136202 TCTGATATGAAAACTGTGGCAGG - Intergenic
1109775914 13:67040699-67040721 ATTGAAATACAGAATGTGGTGGG + Intronic
1109984789 13:69965782-69965804 TCTGAAATGGAGAAAGTGAGTGG + Intronic
1110031909 13:70626488-70626510 TCTGAAATGCACAGTGTGTATGG + Intergenic
1110174038 13:72535417-72535439 TCTTAAATGCAGAATAAAGCGGG - Intergenic
1110261068 13:73485940-73485962 CCAGAAATGGAGAATGTGACTGG + Intergenic
1110481050 13:75976714-75976736 TCTGAAAAGCAGAACATAGCTGG - Intergenic
1112204425 13:97309948-97309970 TCTGTAATGGAGTATGGGGCAGG + Intronic
1113382995 13:109820771-109820793 TCTGAAATCCAGATGTTGGCAGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1115089728 14:29559335-29559357 TCTGAAAAACAGAATGTATCAGG + Intergenic
1116405303 14:44559117-44559139 TTTAAAATGTAAAATGTGGCCGG + Intergenic
1116664563 14:47758392-47758414 TCAGTAATTCAGAATGAGGCAGG - Intergenic
1116838266 14:49792506-49792528 TATAAAATGGAGATTGTGGCTGG - Intronic
1116909790 14:50448309-50448331 TCTAAAATGAAAAAAGTGGCCGG - Intronic
1117882493 14:60325957-60325979 GTTAAAATGCAGATTGTGGCCGG - Intergenic
1118375031 14:65169426-65169448 GCTGAAATGAAGAAGGAGGCTGG + Intergenic
1118718826 14:68579609-68579631 TCTGAAATCCAGATTGTGTTGGG + Intronic
1118768309 14:68924940-68924962 TCTGAAATGCTGAACCTCGCTGG - Intronic
1119259650 14:73230208-73230230 ACTGAAAGGCAGACTGTGACGGG - Intergenic
1120456347 14:84735879-84735901 TAACAAATGCAGAATGTGGTGGG + Intergenic
1120611549 14:86647133-86647155 TCTAAAATTCAGAATCTGGATGG + Intergenic
1120896021 14:89533365-89533387 TCAGATATGCAGATTCTGGCTGG + Intronic
1121230339 14:92352923-92352945 TCTGAAAAGCAGAATGTTGGGGG - Intronic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1122614714 14:103009315-103009337 TCTGGCACGCAGAATGTGCCTGG - Intronic
1122685800 14:103505593-103505615 GTTGAGATGCGGAATGTGGCTGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1124390559 15:29252426-29252448 TGTGTAATGCTGAATTTGGCTGG - Exonic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1126454382 15:48845188-48845210 TGTGAAATTCAGTATGTGGTTGG - Intronic
1127305039 15:57697200-57697222 TTAAAAATTCAGAATGTGGCTGG + Intronic
1129463202 15:75710191-75710213 ACTGAAAGGCAGAATGTGAGGGG - Intronic
1129721683 15:77881210-77881232 ACTGAAAGGCAGAATGTGAGGGG + Intergenic
1129838189 15:78727085-78727107 ACTGTAATGCAGAATGGGGCGGG - Intronic
1130433447 15:83873006-83873028 TTTAAAAGGAAGAATGTGGCTGG + Intronic
1130995867 15:88903784-88903806 TTAGAAATGCAGACTGAGGCCGG - Intronic
1133436807 16:5786837-5786859 TCTGAAAGGTAGAATGAAGCCGG + Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134765775 16:16756425-16756447 TATGAAAGGTACAATGTGGCAGG + Intergenic
1134980278 16:18602794-18602816 TATGAAAGGTACAATGTGGCAGG - Intergenic
1135283020 16:21169603-21169625 TTAGAAATACAGAATCTGGCTGG - Intronic
1135708795 16:24697743-24697765 TTAGAAATGCAGACTGGGGCCGG + Intergenic
1138078296 16:54064604-54064626 TCTGAACTGGGGAATGGGGCAGG + Intronic
1138103649 16:54274834-54274856 TGGGAAATGCAGAATGGGGCTGG - Intergenic
1139717370 16:68824291-68824313 TTAGAAATGTAGAATCTGGCCGG - Intronic
1141064352 16:80901857-80901879 TTTGAAATGCACAATTCGGCAGG + Intergenic
1141277145 16:82598597-82598619 TCTGCAATGTAGAATATGACTGG + Intergenic
1142909012 17:3071451-3071473 GCTGAAATCCTGAATGTGGAAGG + Intergenic
1142925550 17:3232791-3232813 GCTGAAATCCTGAATGTGGAAGG - Intergenic
1142968263 17:3594463-3594485 TCTGAGATTCAGAACGTAGCTGG - Intronic
1143076341 17:4347210-4347232 TCTGAAATCCAGAATGTTTTTGG - Intronic
1143994034 17:10991390-10991412 TTAGAAATGCAGAATCTGCCAGG + Intergenic
1144213218 17:13032641-13032663 GTTAAAATGCAGATTGTGGCTGG + Intergenic
1145234966 17:21201927-21201949 TCTAAAATGCTGCATCTGGCTGG - Intronic
1146018444 17:29252290-29252312 TCAGTTATGCTGAATGTGGCAGG + Intronic
1146458041 17:33022313-33022335 TTTGAAATGCAGCCTGTGACTGG - Intronic
1146946424 17:36876803-36876825 TTAGAAATGCAGAACCTGGCCGG - Intergenic
1147926508 17:43949673-43949695 TCTGAAATGAAGGAGTTGGCAGG - Intergenic
1148995969 17:51709972-51709994 TCTGAACTGCAGAATTTCTCTGG + Intronic
1149002520 17:51771756-51771778 TCTGAGTGGCAGAATGGGGCAGG + Intronic
1149458870 17:56811229-56811251 TATAAAATGCAGAGTTTGGCTGG - Intronic
1150268162 17:63844125-63844147 TTAAAAATGCAGATTGTGGCAGG + Intergenic
1151176202 17:72290217-72290239 TCTGAAATGAAAAATATAGCAGG + Intergenic
1151266730 17:72962347-72962369 GCTGAAATGAAGACAGTGGCTGG + Intronic
1151510204 17:74553988-74554010 TCTAAAAAGAAGATTGTGGCTGG - Intergenic
1151817943 17:76480681-76480703 TTTTAAATTCAGAATGAGGCTGG - Intronic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152106804 17:78334960-78334982 TCTGAAATCCAGGATGGGGAGGG - Intergenic
1153691540 18:7599657-7599679 TCTGGAATGAAAAATGTAGCAGG - Intronic
1154124140 18:11674581-11674603 TCTGAAATGCAGACTGAAGGTGG + Intergenic
1155114805 18:22753531-22753553 TCTGAAATGGTCAATGTGCCAGG - Intergenic
1155532198 18:26778416-26778438 TCTGAAATGCAGCTAGGGGCTGG + Intergenic
1158393271 18:57060772-57060794 CCTGGAATGCAGCATGAGGCTGG + Intergenic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1159093023 18:63870782-63870804 TTAGAAACGCAGAATCTGGCTGG + Intergenic
1159220925 18:65462126-65462148 TTAGAAATGCAGAATCTGACAGG + Intergenic
1160220932 18:76977265-76977287 TCTGAATGGCAGGGTGTGGCTGG + Intergenic
1160343466 18:78110018-78110040 TCAGAGATGCAAAATGTGTCTGG - Intergenic
1162449247 19:10744552-10744574 TGTGGAATGCAGACTGTGGGTGG + Intronic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1163768900 19:19178991-19179013 TCTGAGATGCGGCATGAGGCTGG + Intronic
1163785041 19:19270609-19270631 TCAGACATGCAGAATGAGGCAGG - Intronic
1166285198 19:41821704-41821726 TATGAAATGAAAAATGTGCCGGG + Intergenic
1166954276 19:46452575-46452597 TCTGAAATGCACAGTGGGGCAGG - Intergenic
1167569798 19:50280037-50280059 GCTGAACTGGAGAATGTGTCTGG + Exonic
1167705897 19:51080966-51080988 TTTGAATCCCAGAATGTGGCGGG - Intronic
1202677290 1_KI270711v1_random:19303-19325 TTTGAAATGCAAACTGTGACAGG - Intergenic
1202678066 1_KI270711v1_random:25573-25595 TTTGAAATGCGAACTGTGGCAGG - Intergenic
926376448 2:12232988-12233010 TCTGGAAGGCAGCCTGTGGCCGG + Intergenic
928208358 2:29304199-29304221 TTAGAAATGCAGAATCTGGCTGG + Intronic
928654894 2:33440325-33440347 TCTCAACTACAAAATGTGGCTGG - Intronic
930105306 2:47634554-47634576 TTTAAAATGCAGATTTTGGCTGG + Intergenic
931222877 2:60304167-60304189 TCTTAATTGCAGAATGAGCCGGG - Intergenic
932194701 2:69773393-69773415 TCTGAAAAGCAGTATCTGCCAGG + Intronic
932818299 2:74878990-74879012 CCTGAAATGCAAAATGGAGCTGG - Intronic
933112226 2:78417410-78417432 TCTGAAATGCTGTATGTGTTAGG - Intergenic
933303194 2:80566259-80566281 TCTGAAATGAAAAATGATGCTGG - Intronic
933572518 2:84030050-84030072 TCTGGACTGCAGAATCTGCCAGG - Intergenic
934017599 2:87905327-87905349 TTTGAAATAGAGAATATGGCAGG + Intergenic
935737954 2:106121111-106121133 TGTGAAATGCAGATCCTGGCTGG + Intronic
936105964 2:109624782-109624804 TTAGAAATGCAGAATCTAGCCGG + Intergenic
936111050 2:109665203-109665225 TTTGAGATGCAGAATGATGCTGG + Intergenic
937646418 2:124270412-124270434 TCTGAAATGAGGTGTGTGGCTGG - Intronic
938586765 2:132698536-132698558 TTAGAAATGCAAATTGTGGCCGG + Intronic
939283867 2:140102448-140102470 TCTGAAATCCAGGTGGTGGCAGG - Intergenic
939679088 2:145108460-145108482 TCTGAAAAGAGGAATGTGGTAGG + Intergenic
940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG + Intergenic
941779596 2:169429634-169429656 TCTCAAAGTCAAAATGTGGCTGG - Intergenic
944508900 2:200445031-200445053 TCTAAAAGTGAGAATGTGGCAGG + Intronic
946365031 2:219243808-219243830 TTAGAAATGGAGAATCTGGCTGG + Intronic
948062845 2:235054253-235054275 GTTGAAATGCAAAGTGTGGCCGG - Exonic
948189333 2:236045920-236045942 TCTGAAACCCAAAATGTTGCAGG - Intronic
948307562 2:236960552-236960574 TCTGAGATCAAGAATGTGACAGG - Intergenic
948571957 2:238923213-238923235 TCTAAAAAGCATAATGTGGCTGG + Intergenic
1168749674 20:273577-273599 TTAGAAATGCAGAATCAGGCTGG + Intronic
1169046056 20:2535292-2535314 TCTGAAAAGCGGTCTGTGGCTGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1172976825 20:38912366-38912388 TTAGAAATGCAGACTTTGGCTGG + Intronic
1174642285 20:52054946-52054968 TCTAAAATGAGGAATTTGGCCGG - Intronic
1174735228 20:52959848-52959870 TCAGAAATGCGGCATCTGGCCGG + Intergenic
1175335534 20:58193531-58193553 TCTGAAATTCAGAGCCTGGCTGG - Intergenic
1175562713 20:59944717-59944739 TCTCAAATGCATAATGTGATGGG - Exonic
1177027889 21:15943926-15943948 TATGAAATCCAAAATTTGGCTGG + Intergenic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178247087 21:30963723-30963745 GCTGAAATGCAGAATGCCTCAGG - Intergenic
1178397930 21:32259168-32259190 TCAGAAATGCAGACCCTGGCTGG - Intergenic
1178624114 21:34201551-34201573 CAAGAAATGCAGAAGGTGGCAGG - Intergenic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1180020029 21:45117493-45117515 ACTGACATGCAGGATGTGACGGG - Intronic
1180116229 21:45707217-45707239 TTTAAAATGCAGATTCTGGCTGG + Intronic
1181159290 22:20947978-20948000 TGTGAAAAGCACAAAGTGGCCGG - Intronic
1183837819 22:40471083-40471105 TCAGAAATGCAAAAGGAGGCCGG + Intronic
1184059332 22:42072716-42072738 TCTGAGATGTGGAAAGTGGCCGG - Intergenic
949145225 3:691392-691414 ACTGCACTGCAGAGTGTGGCTGG + Intergenic
949288105 3:2430125-2430147 TTAGAAATGCAGAAATTGGCCGG + Intronic
949608892 3:5683533-5683555 TCTGAAATGGAGATGCTGGCAGG + Intergenic
950149951 3:10679152-10679174 GCTGCAATCCAGGATGTGGCTGG - Intronic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951595747 3:24316503-24316525 TCTGAACTGTAGCATGTGGTGGG - Intronic
957225120 3:77433267-77433289 TCTGAAATGCAGGAGGAGTCTGG - Intronic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
960104614 3:113781200-113781222 TTTGAAATATAGAAAGTGGCAGG - Intronic
960602781 3:119474537-119474559 TTTGAAAAGCCAAATGTGGCCGG + Intronic
962374021 3:134845635-134845657 TGTGGGATGCAGAATGTGGCTGG - Intronic
962963596 3:140333609-140333631 GATGAAATGCCTAATGTGGCGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963483819 3:145910879-145910901 TCTGTAATTCATAATCTGGCTGG + Intergenic
963930889 3:151003341-151003363 TCTGAAATTCAGTATGTGTTGGG + Intergenic
963938734 3:151080361-151080383 CATGAAATGCAAAATGTGGCTGG + Intergenic
965070490 3:163910764-163910786 TGTGAAATGAATAATGTGGAGGG - Intergenic
966197366 3:177326713-177326735 TCTGCAAAGCAGTATGTGGACGG - Intergenic
966783553 3:183605724-183605746 TTTGAAATACAAAATTTGGCCGG + Intergenic
966901262 3:184487631-184487653 TCTAATATACAGAATCTGGCCGG - Intronic
967420124 3:189263179-189263201 GCTGAAATCCTGAAAGTGGCAGG - Intronic
970160166 4:13180218-13180240 TCTGAAATGGAGATGCTGGCAGG + Intergenic
971659573 4:29394664-29394686 TTTGAAATAGAGAATTTGGCTGG - Intergenic
972370730 4:38420746-38420768 ACTCAAATGCTGAAAGTGGCTGG + Intergenic
972602321 4:40583561-40583583 TCTTAAAAGCAGAATGGGCCAGG + Intronic
974362473 4:60900038-60900060 TCAGGAGTGCAGAATGTGGGGGG + Intergenic
975809630 4:78153315-78153337 TCTGGGATCCAGAATGGGGCCGG + Intronic
976295794 4:83470386-83470408 TCTGTATTTCAGAATGTGGTAGG - Exonic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
977718125 4:100207150-100207172 GCTGAAGTGCATAATGTGGATGG + Intergenic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
980478936 4:133359558-133359580 TCTGAAATCAAGGATTTGGCAGG + Intergenic
980740527 4:136944777-136944799 TCTGAAATCAAGATTGTAGCAGG - Intergenic
981081474 4:140642976-140642998 ACTGGACTTCAGAATGTGGCGGG - Intronic
981774106 4:148345159-148345181 TCTGAACCACAGAATCTGGCAGG - Intronic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
987647463 5:20692985-20693007 TCTCTTATGCAGAATGTGTCTGG + Intergenic
988293639 5:29325076-29325098 TCTGAAATCAAGATGGTGGCAGG - Intergenic
988406491 5:30829998-30830020 TCTGAAATGCAGAAAGTAACAGG + Intergenic
989209235 5:38843750-38843772 TCTGAAATGAAGATGTTGGCAGG + Intergenic
989450531 5:41581873-41581895 TCTGAAATGAAGAATTTTTCAGG + Intergenic
990806357 5:59667075-59667097 TATGAAATGGACAATGTGGGTGG + Intronic
991454966 5:66793209-66793231 TCTGAAATGCCCAATGTGTCTGG - Intronic
992911909 5:81403226-81403248 TATGAAAACAAGAATGTGGCAGG - Intergenic
995012479 5:107273242-107273264 TCAGATATTCAGAATGTGGTTGG + Intergenic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
996954830 5:129170251-129170273 TTAGAAATGCAGAATATGGGTGG - Intergenic
997877062 5:137559048-137559070 TCTGAGATGCAGATTCTTGCTGG + Intronic
998420578 5:141981565-141981587 TGTAAAATGCAGAATGGGGCTGG + Intronic
999387207 5:151162584-151162606 TGTGAATTGCAGAATGTTGGGGG + Intergenic
999969388 5:156844114-156844136 TCTGTACAGCTGAATGTGGCTGG - Intergenic
1001028697 5:168245934-168245956 TTCAAAATGCAGGATGTGGCTGG + Intronic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1003461251 6:6330772-6330794 TCTGAAATCCGTAATGTGCCAGG - Intergenic
1003897175 6:10618143-10618165 TCTGAGGCGCAGAAAGTGGCAGG - Intronic
1004339508 6:14795805-14795827 TCTGAATTGCAAAATGGGGGAGG - Intergenic
1005872660 6:29986642-29986664 TTTGAAATGCAGAATTCTGCTGG + Intergenic
1006506850 6:34494731-34494753 TTAGAAATGCAGGCTGTGGCTGG - Intronic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1008538474 6:52526030-52526052 TCTGAAATCAAGATGGTGGCAGG - Intronic
1009323704 6:62323381-62323403 ACTGGAAAGCAGAATATGGCAGG + Intergenic
1010753193 6:79637394-79637416 TTTGAAAATCAAAATGTGGCCGG + Intronic
1013517520 6:110901804-110901826 TCTAAAATGCTAAAGGTGGCCGG - Intergenic
1014278036 6:119408975-119408997 TCTGAAATGCAAAATTTGAGTGG - Intergenic
1014586866 6:123209009-123209031 TCAGAATTACAGAATGTGGCAGG + Intergenic
1014892323 6:126857846-126857868 TTAAAAATGCAGAATGGGGCTGG - Intergenic
1015029202 6:128573902-128573924 TCTGAAAAGCAGAATGTGTCAGG - Intergenic
1015429062 6:133108894-133108916 TCTGAACTGCAGAGTGTTGCTGG - Intergenic
1015585405 6:134771058-134771080 ACTGAAAAGCAGGACGTGGCTGG - Intergenic
1018762746 6:166905661-166905683 TCTGAAAGGCAGGAAGCGGCAGG + Intronic
1019060900 6:169256727-169256749 TTTTAAATGCAGTGTGTGGCAGG - Intergenic
1020272894 7:6607515-6607537 CCTGAAATTCAGAATGAGTCCGG - Intronic
1020539852 7:9447495-9447517 TCTGAAATAAAGCATGTAGCTGG + Intergenic
1021566650 7:22023158-22023180 CCAGAAATGCAGAATCTGGCCGG - Intergenic
1024667541 7:51561768-51561790 TCTGAAAGGCAGACTGTGATGGG + Intergenic
1025172137 7:56768845-56768867 TCTGCAACACAGTATGTGGCAGG + Intergenic
1025835633 7:65090987-65091009 TTTGAGATGCAGAATTTGTCTGG + Intergenic
1026467638 7:70668273-70668295 TTAGAAATGCAGAATCTGGCTGG - Intronic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1029545760 7:101209835-101209857 TCTTAAAAGAAGAATGGGGCTGG - Intronic
1030615113 7:111730559-111730581 CCTGAAATTCAAAATATGGCAGG + Intronic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031553713 7:123146226-123146248 TGTTAAATTCATAATGTGGCCGG + Intronic
1031923294 7:127616484-127616506 TCTGAAGTGCAGCATTTGGGTGG - Intergenic
1032499252 7:132387734-132387756 TCTGTAATGGAGATTGTGGGCGG + Intronic
1032634474 7:133691669-133691691 TATGAAATCCAGTAAGTGGCAGG + Intronic
1035210177 7:157321991-157322013 TATGAAATACAGAATTAGGCCGG + Intergenic
1036105166 8:5830363-5830385 TCAGCAATGCAGAAACTGGCCGG - Intergenic
1036395479 8:8366967-8366989 TCTAAAATGCATGATGTAGCTGG - Intronic
1036919910 8:12842445-12842467 TTTAAAATGCAGACTGTGCCTGG + Intergenic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1039027989 8:33278968-33278990 TCTGAAAGGCACAATGTGATGGG + Intergenic
1041299395 8:56394911-56394933 TCTGACATGCAGAATCAAGCAGG + Intergenic
1041567457 8:59295860-59295882 TCTCAATTACAGAATGTGGGTGG + Intergenic
1043743572 8:83844592-83844614 TCTGAACTTCAGAATGTGAAGGG - Intergenic
1045052856 8:98342662-98342684 TCGGTAATGCAGAATGGGGTTGG - Intergenic
1047573752 8:126130758-126130780 TCTGAAATCCAGATGTTGGCAGG - Intergenic
1047794091 8:128236225-128236247 TGTGATTTGCAGAATCTGGCTGG - Intergenic
1047861539 8:128972560-128972582 GCTGAAATGAAGAGAGTGGCAGG - Intergenic
1048264586 8:132974288-132974310 GGTGAAATAAAGAATGTGGCTGG - Intronic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1049042106 8:140120307-140120329 GCTGAAATGATGAATGAGGCGGG + Intronic
1050718094 9:8552951-8552973 TGGGTAATGCAGAATGTGTCTGG - Intronic
1051060929 9:13044215-13044237 TTTGAAAAGTAAAATGTGGCAGG - Intergenic
1051068092 9:13129164-13129186 TCAGAAAAGCAGGATGAGGCTGG + Intronic
1051345084 9:16144149-16144171 TCAGAAAAGCAGAGTGTGGGTGG - Intergenic
1056028965 9:82531045-82531067 TCTGAAATCAAGATTTTGGCAGG + Intergenic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059300385 9:113307850-113307872 TTAGAAATGCAAAATCTGGCCGG + Intergenic
1059531509 9:115039683-115039705 TCTGAGAGCCAGGATGTGGCAGG + Intronic
1059578132 9:115514004-115514026 GCAGAATTGGAGAATGTGGCTGG + Intergenic
1060239734 9:121892723-121892745 TCTTCCATGGAGAATGTGGCGGG - Intronic
1060762435 9:126267228-126267250 TTAGAAATGCAGAATCTGCCGGG - Intergenic
1061273590 9:129557555-129557577 TCTGGAATGCAGCCTGGGGCGGG + Intergenic
1062157444 9:135060926-135060948 TCTGAAATCCAGAGAGTGGTTGG - Intergenic
1186403265 X:9279018-9279040 TCTGAAATGCTGGATGAGGAAGG + Intergenic
1186552615 X:10522384-10522406 TCTGAAATCAAGATTTTGGCAGG - Intronic
1186787356 X:12965952-12965974 TGTGTAATGAAGAATTTGGCTGG - Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG + Intergenic
1192918019 X:75674475-75674497 CATGGAATTCAGAATGTGGCTGG + Intergenic
1193212555 X:78824521-78824543 TTTGAAAAGCTGAATGTTGCAGG - Intergenic
1194096373 X:89644744-89644766 TCTGATATCCAGAATGTAACAGG + Intergenic
1194582088 X:95686668-95686690 TCTTAAATGCATTATGTTGCTGG - Intergenic
1194723625 X:97369202-97369224 TCTGAAAGGTAGATTCTGGCTGG - Intronic
1195527877 X:105913796-105913818 TCTGGAATGCAGTTTGTGACAGG + Intronic
1198189793 X:134291131-134291153 ACAGAAATCCAGAATGTGTCAGG + Intergenic
1199126883 X:144133218-144133240 TTTGAAATAGAGAATATGGCAGG - Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199574793 X:149303221-149303243 TCTGAAATCCAAAATGTTTCTGG - Intergenic
1200449380 Y:3306119-3306141 TCTGATATCCAGAATGTATCAGG + Intergenic
1201341362 Y:12937684-12937706 TCTAAAATGCAGATTTGGGCTGG - Intergenic
1202106637 Y:21376269-21376291 CCTGAAATCCAGAATATGGAGGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic