ID: 1124677251

View in Genome Browser
Species Human (GRCh38)
Location 15:31696753-31696775
Sequence GTGGGCACCCACCCCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124677251_1124677256 -10 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677256 15:31696766-31696788 GGGTGCCCACTTGGAGGGCCTGG 0: 2
1: 0
2: 1
3: 22
4: 192
1124677251_1124677257 -9 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677257 15:31696767-31696789 GGTGCCCACTTGGAGGGCCTGGG 0: 2
1: 0
2: 2
3: 23
4: 168
1124677251_1124677258 -8 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677258 15:31696768-31696790 GTGCCCACTTGGAGGGCCTGGGG 0: 2
1: 0
2: 0
3: 17
4: 216
1124677251_1124677261 -3 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677261 15:31696773-31696795 CACTTGGAGGGCCTGGGGCTAGG 0: 1
1: 1
2: 1
3: 44
4: 418
1124677251_1124677263 15 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677263 15:31696791-31696813 CTAGGTGTCTGCAGCCTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 161
1124677251_1124677266 30 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677266 15:31696806-31696828 CTTTCAGGGCAAATGCAGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 156
1124677251_1124677264 16 Left 1124677251 15:31696753-31696775 CCCAGATGGGGGTGGGTGCCCAC 0: 2
1: 0
2: 2
3: 26
4: 186
Right 1124677264 15:31696792-31696814 TAGGTGTCTGCAGCCTTTCAGGG 0: 1
1: 0
2: 5
3: 51
4: 846

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124677251 Original CRISPR GTGGGCACCCACCCCCATCT GGG (reversed) Intronic
900347480 1:2216559-2216581 GTGTCCACCCAACCCCACCTTGG - Intergenic
901507157 1:9692147-9692169 GTTGGCTACCACACCCATCTGGG + Intronic
902539596 1:17144568-17144590 GTGGGCACTCAAGCCCAACTTGG + Intergenic
903567994 1:24283524-24283546 GTGGGCACCCACCTGTCTCTGGG - Intergenic
904190013 1:28736499-28736521 GTGATACCCCACCCCCATCTGGG - Intergenic
904876031 1:33655121-33655143 GCTTGCACCCACTCCCATCTGGG - Intronic
906513302 1:46423744-46423766 CAGGGCACCCACGCACATCTCGG - Intergenic
911210325 1:95132170-95132192 GTGAGCCACCACGCCCATCTGGG - Intronic
915275363 1:154784544-154784566 GAAGGCACCCAGCCCCACCTGGG - Intronic
915480037 1:156178201-156178223 CTGTGCATCCACCCCCATCCTGG + Intergenic
915607855 1:156964826-156964848 GTGCTCACCCACCACCTTCTGGG - Intronic
915675607 1:157527155-157527177 GTGGGAACCCAACCCACTCTGGG + Intronic
916916919 1:169417095-169417117 GTGGGAACCCTTCCCCATTTTGG - Intronic
918110367 1:181450312-181450334 GTGAGTGCCCAACCCCATCTTGG + Intronic
920055806 1:203190598-203190620 GTGTGCAACCACACCCAGCTGGG + Intergenic
921031861 1:211341094-211341116 GGGCACACCCACCCCCATTTGGG + Intronic
924252059 1:242142866-242142888 GCAGGCACCCACCACCATGTTGG + Intronic
1062766091 10:66364-66386 GTGGGCCACCACCCCCAGCCTGG - Intergenic
1067095066 10:43294674-43294696 GTGGTCACCCACCCCCTCCTGGG + Intergenic
1067095099 10:43294761-43294783 GTGGTCACCCACCCCCTCCTGGG + Intergenic
1067478652 10:46581806-46581828 CTGGGCACCCATCCCCATCCTGG - Intronic
1067616085 10:47759995-47760017 CTGGGCACCCATCCCCATCCTGG + Intergenic
1069576040 10:69529079-69529101 GTTGGCACCCACTCCAATCTTGG - Intergenic
1074373389 10:112918930-112918952 ATGGGCTCCCACCCCTTTCTGGG + Intergenic
1074722070 10:116272385-116272407 GTGAGGACCCACCCCCACCCAGG + Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076696953 10:132251585-132251607 GTGGGCACCCACCACCCTCTTGG - Intronic
1076876525 10:133218972-133218994 GCGGGTACCCACCCCCGCCTTGG - Intronic
1077132696 11:981498-981520 GTGAGCACCCAACACCATGTGGG + Intronic
1077222233 11:1422856-1422878 GTGGGCAGCGGCCCCCAGCTGGG - Intronic
1077223020 11:1425743-1425765 TTGGGAACCCACCCCCTTCTGGG + Intronic
1077251585 11:1563167-1563189 ATGTGCACCCTCCCCCATCCAGG - Intronic
1077383707 11:2259325-2259347 GTGGGCACATACCCCCATGAGGG - Intergenic
1077460265 11:2705580-2705602 GGGGGCACACACCCCGAGCTTGG - Intronic
1080848203 11:36044833-36044855 GTGGGCGCCCACCCCCAGAGTGG + Intronic
1081651027 11:44824358-44824380 CTGATCACCCACCCCCAACTGGG + Intronic
1082240651 11:49866717-49866739 GTGGGCCCCCACTCTCTTCTGGG - Intergenic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1083686554 11:64379452-64379474 GTGTGCTCCCACGCCCATCCTGG - Intergenic
1083812999 11:65116068-65116090 GTGGGCACATGCCCCCACCTGGG - Exonic
1084148538 11:67277548-67277570 CTGGGCCCCCACCCCCACCACGG - Intronic
1084184666 11:67465151-67465173 GGGGGCTCCCACCCCCAGCCCGG + Intronic
1084700954 11:70785783-70785805 TTGGGCATCATCCCCCATCTCGG + Intronic
1085515106 11:77107124-77107146 GTGGGCACCCCCTGCCTTCTTGG - Intronic
1087720562 11:101660622-101660644 GTGAGCAACCACACCCAGCTCGG + Intronic
1089500426 11:118928771-118928793 CTGCGCCCGCACCCCCATCTTGG + Intronic
1089650564 11:119910199-119910221 GAGGGCAGCCAGCCCCACCTGGG - Intergenic
1090662560 11:128892099-128892121 GGGGGCACCGCCCCCCATCCTGG - Intronic
1093493077 12:19726407-19726429 GTTGGCACCCACTCTGATCTTGG - Intergenic
1094470929 12:30800400-30800422 GTGGGCCCCCACCCCCATGATGG + Intergenic
1095457508 12:42404385-42404407 ATAGGCACCCACCACCATGTTGG - Intronic
1095593347 12:43931056-43931078 GTGAGAACCCACCCCAAGCTGGG + Intronic
1101421603 12:104555642-104555664 GTGGGGCCCAACCCCCATCCTGG - Intronic
1103848938 12:123918519-123918541 GAGGGCACCCACCCTCTTGTAGG - Intronic
1105531024 13:21220594-21220616 GTGCCCACCCACCCCCAACTGGG - Intergenic
1106251712 13:27986974-27986996 GTGGACACTCACCCACTTCTGGG - Intronic
1112321314 13:98410214-98410236 GTGGGCAGCCAGCCCCACCGTGG - Intronic
1122732809 14:103814065-103814087 GTGAGCCACCACGCCCATCTGGG - Intronic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1125717121 15:41825714-41825736 GAGGGCAGCCTGCCCCATCTAGG + Exonic
1129330509 15:74824658-74824680 CTCGGCCCCCAGCCCCATCTGGG + Intronic
1129369083 15:75076725-75076747 GTTGGCACCCACTCCAATCTTGG - Intronic
1133720685 16:8491637-8491659 TTTGCCACCCACCCCCACCTTGG - Intergenic
1135414396 16:22257760-22257782 CTGGGCACCCACCAGCAGCTTGG - Exonic
1136065114 16:27753532-27753554 GTGGGCCACCACACCCTTCTTGG - Intronic
1136428417 16:30183951-30183973 CCGGCCACCCACCTCCATCTTGG - Intronic
1137564277 16:49523612-49523634 GTGGGCACCCACCTGCAGCTCGG + Exonic
1139379398 16:66521113-66521135 GTGGGCACCCTCCCAGCTCTGGG - Intronic
1139513107 16:67438312-67438334 CTGGGCACCCCCCCCCACCAAGG - Exonic
1141714732 16:85720279-85720301 CTGGGCACCTTCCCCCACCTTGG - Intronic
1141780299 16:86155096-86155118 GTGGGGACCGAAGCCCATCTGGG - Intergenic
1142411509 16:89919323-89919345 GTTGGCAGCCAGCCCCAGCTGGG - Exonic
1144056951 17:11551664-11551686 ATGGTGACCCACCCACATCTCGG - Intronic
1146277385 17:31524259-31524281 GTGGATCCCCACTCCCATCTTGG - Intronic
1148486723 17:47995461-47995483 GGGGGCAGCCGCCCCCATCATGG - Intergenic
1148746876 17:49923500-49923522 GGGGACCCCCACCCCCATCAAGG + Intergenic
1151167781 17:72219786-72219808 ATGTGCCCCCACCCCCCTCTGGG - Intergenic
1151385625 17:73753600-73753622 GTGCCCACCCAGCCTCATCTAGG - Intergenic
1151663825 17:75534203-75534225 GTGGGAACGCACCCCCATTCTGG - Intronic
1151977462 17:77490669-77490691 GGGGGCACCCACCCCCAAGCAGG - Intronic
1153695918 18:7641573-7641595 GTGGGCAACCGCCCACTTCTTGG - Intronic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155543466 18:26889676-26889698 GTGGGCACCCCCCACGATATGGG - Intergenic
1158198155 18:54910843-54910865 GTTGGCACCCTCCCCAATCTCGG - Intronic
1158277216 18:55781137-55781159 GTGGAGACCCTGCCCCATCTGGG - Intergenic
1160094646 18:75860432-75860454 GTGAGCCACCACCCCCAGCTGGG - Intergenic
1160914439 19:1490074-1490096 GTGGGCTCCCTCCCCCTTGTCGG + Intronic
1162907651 19:13833206-13833228 GGCGCCCCCCACCCCCATCTTGG - Intergenic
1163326510 19:16606834-16606856 GTGGGAACCCAAACCCACCTGGG + Intronic
1163833875 19:19561907-19561929 ATGGGCACCACCACCCATCTGGG + Exonic
1164309039 19:24030381-24030403 ATGGGCATCAACCCCCATCCAGG - Intergenic
1164672083 19:30077984-30078006 GTGGGCACCCAGCCCCAGCCTGG + Intergenic
1166046605 19:40234032-40234054 GTGGGCAGCCCCCGCCAGCTGGG - Intronic
1166316822 19:41994059-41994081 CTCAGCACCTACCCCCATCTTGG + Exonic
1167490036 19:49787303-49787325 GTGAGCCACCACTCCCATCTAGG + Intronic
1168334879 19:55592061-55592083 ATGGGCACCCACCCCCACCAAGG - Exonic
925048114 2:789861-789883 GTTGGCACTCACTCCAATCTTGG + Intergenic
928245778 2:29625865-29625887 CTTGGCACCCACCACCCTCTTGG - Intronic
930611927 2:53553910-53553932 GTTGGCACCCACTCCAATCTTGG + Intronic
933090108 2:78108145-78108167 CTGGGCACCTGCCTCCATCTAGG + Intergenic
933697818 2:85233214-85233236 GTGAGCCCCCACACCCATCCTGG + Intronic
934558452 2:95299873-95299895 GAGGGTACCAACGCCCATCTAGG + Intronic
946467506 2:219925080-219925102 CTGGGCACCTACCCCCATGTTGG - Intergenic
948788620 2:240365749-240365771 GTGGGCACCCACCCCTCTCCTGG + Intergenic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1169211074 20:3766666-3766688 GTGTGCTCCCACCCTCACCTTGG - Intronic
1171104120 20:22416210-22416232 GTGGTTACCCACGCACATCTTGG - Intergenic
1172566052 20:35931362-35931384 GTGGCCACCCACCAGCTTCTTGG + Exonic
1172632907 20:36391095-36391117 GAGGGGCCCCACCCCCATTTAGG + Intronic
1174017238 20:47498852-47498874 GTGGGCCACCACACCCAACTAGG + Intergenic
1178533496 21:33394079-33394101 ATGAGCACCCAGCCCCATTTGGG + Intergenic
1182685443 22:32119553-32119575 GAGGGCACCCTCCTCCTTCTGGG - Intergenic
1183377303 22:37472653-37472675 GTGGGCTCCCACCACCAGCGGGG - Intronic
1184689228 22:46109968-46109990 CTGGGCCCCCAGCCCCACCTGGG - Intronic
949401594 3:3670310-3670332 GTTGCCACCCCCACCCATCTTGG - Intergenic
953774550 3:45804085-45804107 GTGGGCTCCCACTCCCTCCTGGG + Intergenic
955920414 3:63948785-63948807 GTGGGCCAGCACCCACATCTAGG - Intronic
957053309 3:75426427-75426449 GTGAGCCCCCACGCCCACCTGGG - Intergenic
960982991 3:123249394-123249416 GTGGTAACCAGCCCCCATCTAGG + Intronic
962353884 3:134677489-134677511 GTGCCCACCTACCTCCATCTGGG + Intronic
964996727 3:162891540-162891562 GTCAGCACCCACTCCAATCTCGG + Intergenic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
968689515 4:1983537-1983559 GGGGGCACCCGCCCCCAACCCGG + Intronic
968857710 4:3139971-3139993 GTGAGCCCCCACGCCCAGCTGGG - Intronic
969514416 4:7638545-7638567 GTGGGCACTCACCTCCAGGTGGG - Intronic
985869449 5:2542681-2542703 GTGGGGACCAGCCCCAATCTTGG + Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
992559930 5:77941370-77941392 CTCCCCACCCACCCCCATCTTGG + Intergenic
992805213 5:80330867-80330889 GTGGGCTACCACGCCCAGCTGGG - Intergenic
997515593 5:134487081-134487103 ATGGGCACCCACCACCACATTGG + Intergenic
1000802553 5:165746985-165747007 GTGGGCCACCACACCCAGCTAGG + Intergenic
1003391639 6:5718336-5718358 GTGCCCACCCACCCCCAACTGGG + Intronic
1003504085 6:6725528-6725550 GTGGGCCTCCCCCTCCATCTGGG + Intergenic
1006358713 6:33575637-33575659 TTGGGCTCCCACCCCCATCCAGG - Intronic
1009222508 6:60997641-60997663 GTGTGCACCCACAGCCATATTGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366539 6:62861437-62861459 GTGGACACCCTTCCCCATTTGGG - Intergenic
1019607476 7:1917389-1917411 GTGGGCACCCAGCCCTGTCTCGG - Intronic
1019695093 7:2441212-2441234 GTTGTCTCCCTCCCCCATCTAGG - Intergenic
1019897974 7:3997889-3997911 GTTGGCACCCACTCTGATCTGGG - Intronic
1020081951 7:5291028-5291050 GTGGGCAGCGAGCCCCTTCTGGG + Intronic
1025196966 7:56941110-56941132 GTGGGCAGCGAGCCCCTTCTGGG - Intergenic
1025209284 7:57011664-57011686 GATGCCATCCACCCCCATCTAGG - Intergenic
1025662661 7:63565190-63565212 GATGCCATCCACCCCCATCTAGG + Intergenic
1025674982 7:63635827-63635849 GTGGGCAGCGAGCCCCTTCTGGG + Intergenic
1026322406 7:69279126-69279148 ATGGGCTCCGACCCCCAGCTGGG - Intergenic
1028816922 7:95157159-95157181 GTGGGCACCTGCTCCCATCTTGG - Intronic
1028909944 7:96196487-96196509 GTGAGCACCAGCCCCCACCTTGG - Intronic
1029202367 7:98847724-98847746 GTGGGCAGCCAGGCCCACCTGGG + Exonic
1029714319 7:102317765-102317787 GTTGGCTCCCACCCCCCACTGGG - Intronic
1034269919 7:149798441-149798463 GTGGCCTCCCACCCCCATGGGGG - Intergenic
1036411629 8:8506877-8506899 CTGGCCACCCAGCCCCAGCTTGG - Intergenic
1043690701 8:83147344-83147366 GAGTGCACTCACCCCCATATCGG + Intergenic
1046728968 8:117704880-117704902 GTGGGTACACACCCCCATAGTGG - Intergenic
1049001074 8:139826004-139826026 ATGGGCTCTCACCCCCACCTGGG - Intronic
1049377114 8:142294541-142294563 GTGGGCACCCTGCCTCCTCTGGG + Intronic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1049618149 8:143585359-143585381 GTGGGCATCCACCAGAATCTGGG + Intronic
1050165444 9:2760358-2760380 ATGGGCAACCACGCCCAGCTAGG - Intronic
1051512561 9:17894917-17894939 CTGGGCAGCCACCCTGATCTTGG + Intergenic
1053180018 9:35960768-35960790 GTGGGCAGCCACCTTCATCAAGG - Intergenic
1055333802 9:75211012-75211034 GTGGGCACCTAACGCCTTCTAGG - Intergenic
1055562042 9:77530786-77530808 GTGAGGACACTCCCCCATCTGGG - Intronic
1057468459 9:95337353-95337375 GTCGGCGCCCACTCCAATCTGGG + Intergenic
1059676496 9:116545244-116545266 ACTGGCACCCAGCCCCATCTAGG - Intronic
1060938016 9:127527123-127527145 GTGTGCCCCCTCCCCCAACTCGG - Intronic
1061138449 9:128750396-128750418 CTGGGCCCCCACCCCCACATGGG + Intronic
1061589858 9:131591326-131591348 CTGGGCAGCCACCACCACCTGGG - Intronic
1062076633 9:134593328-134593350 GACAGCCCCCACCCCCATCTAGG + Intergenic
1062598718 9:137310715-137310737 GTGGGCACCCAGCCCCCTCCTGG - Intronic
1062739150 9:138157931-138157953 GTGGGCCACCACCCCCAGCCTGG + Intergenic
1203444806 Un_GL000219v1:45069-45091 GTGGGCGGAGACCCCCATCTCGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187256548 X:17648263-17648285 GTTGTCCCCTACCCCCATCTTGG - Intronic
1189068413 X:37836729-37836751 GTGGGCAACCACCCCTATTCTGG - Intronic
1189664924 X:43343788-43343810 GTGAGCCCCCACGCCCAGCTGGG + Intergenic
1190232488 X:48593097-48593119 GTTGTCACCAACCCCCATTTGGG + Intronic
1190398366 X:50007261-50007283 CTGGGCACCCAGCCACATGTGGG - Intronic
1190874361 X:54449229-54449251 GCGGGCACCTACGCCCATCCGGG - Exonic
1192436205 X:71145237-71145259 GAGGGCCCCCAGCCCCATCCCGG + Intronic
1193547624 X:82849254-82849276 GTGAGAACTCACCCCCACCTGGG - Intergenic
1195010973 X:100731903-100731925 AAGCGCCCCCACCCCCATCTCGG - Intronic
1195126435 X:101813547-101813569 GTTGGCACCCACTCCAATTTCGG + Intergenic
1195750941 X:108161671-108161693 GTGGGCTCCCAGGCCCACCTGGG - Exonic