ID: 1124678051

View in Genome Browser
Species Human (GRCh38)
Location 15:31704346-31704368
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124678047_1124678051 10 Left 1124678047 15:31704313-31704335 CCCTTTACAGCTCTTCCTTAAAT 0: 2
1: 0
2: 4
3: 33
4: 293
Right 1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG 0: 2
1: 0
2: 0
3: 4
4: 77
1124678048_1124678051 9 Left 1124678048 15:31704314-31704336 CCTTTACAGCTCTTCCTTAAATA 0: 2
1: 1
2: 1
3: 24
4: 238
Right 1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG 0: 2
1: 0
2: 0
3: 4
4: 77
1124678044_1124678051 24 Left 1124678044 15:31704299-31704321 CCCACTCCTGGAGACCCTTTACA 0: 2
1: 0
2: 1
3: 7
4: 99
Right 1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG 0: 2
1: 0
2: 0
3: 4
4: 77
1124678049_1124678051 -5 Left 1124678049 15:31704328-31704350 CCTTAAATACTGATTTTTCCTTA 0: 2
1: 0
2: 1
3: 36
4: 472
Right 1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG 0: 2
1: 0
2: 0
3: 4
4: 77
1124678046_1124678051 18 Left 1124678046 15:31704305-31704327 CCTGGAGACCCTTTACAGCTCTT 0: 2
1: 0
2: 1
3: 18
4: 584
Right 1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG 0: 2
1: 0
2: 0
3: 4
4: 77
1124678045_1124678051 23 Left 1124678045 15:31704300-31704322 CCACTCCTGGAGACCCTTTACAG 0: 2
1: 0
2: 0
3: 13
4: 118
Right 1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG 0: 2
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900210175 1:1451741-1451763 CCTTAAGCCCAGCCTGAATCAGG + Intronic
900215725 1:1480562-1480584 CCTTAAGCCCAGCCTGAATCAGG + Intronic
903043491 1:20549617-20549639 TCTCAAGTATTGCATGTATCTGG - Intergenic
904802352 1:33102627-33102649 CTTTAAGTGCTGACTGTCTCAGG + Intronic
905521885 1:38606741-38606763 CCTTAAGTCCTGGCAGTTTCTGG + Intergenic
906140016 1:43528735-43528757 CCTTCAATACTGCCCGTCTCAGG - Intronic
908279996 1:62523276-62523298 TCTGAAATACTGCCTGTATATGG - Intronic
908436755 1:64114481-64114503 CTTTCAGTACTACCTGTATCAGG - Intronic
911223545 1:95278165-95278187 CCTTCAGAAATGCCTGGATCTGG - Intergenic
915016397 1:152737908-152737930 CCTCCAGTACTGCTTGTATGAGG - Intronic
918264453 1:182828273-182828295 CCTTAAGTACTGCATTTCTTAGG + Intronic
921436294 1:215127191-215127213 CGTGAAGCACTGCCTGTACCAGG - Intronic
1066410351 10:35162719-35162741 GCTTCAGTACTGCCTGAAGCAGG - Intronic
1080633853 11:34106035-34106057 CTCTAAGTAGTGCCTGTAACTGG + Intronic
1081328225 11:41771881-41771903 CCTTAAGGACTTCCTGGAACTGG + Intergenic
1089879949 11:121763907-121763929 CCTGAAGTTCTCCCTTTATCAGG + Intergenic
1097131934 12:56817785-56817807 CCTTCAGTTCTGCCTGTGTGAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101305899 12:103527607-103527629 CCTGAAATACTGATTGTATCAGG - Intergenic
1103340022 12:120216260-120216282 CTTTAAGGCCTGCCTGCATCGGG + Intronic
1105239169 13:18595262-18595284 CCTAAATTCCTGCCTGTACCAGG - Intergenic
1107166629 13:37289659-37289681 CCTTCAGTATTGCCTGTGACTGG + Intergenic
1107235719 13:38167597-38167619 CCTTAAGTACTGTCAGTTTTTGG - Intergenic
1110248687 13:73356869-73356891 CCTCAAATACTTCCTATATCAGG - Intergenic
1114751919 14:25214242-25214264 CCTTAAGCACTGCAGGAATCTGG - Intergenic
1119437493 14:74606929-74606951 CACTTAGTACTGCCTGTCTCAGG + Intronic
1123492082 15:20788822-20788844 CCTAAATTCCTGCCTGTACCAGG + Intergenic
1123548586 15:21357912-21357934 CCTAAATTCCTGCCTGTACCAGG + Intergenic
1124553190 15:30701325-30701347 CCTTAAGTACTGCCTGTATCAGG - Intronic
1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG + Intronic
1125547380 15:40516254-40516276 CCTTGAGTACTGCATGTGCCAGG + Intergenic
1129828604 15:78652160-78652182 CAGTAATTCCTGCCTGTATCTGG + Intronic
1130832203 15:87612497-87612519 TTTAAAGTACTGTCTGTATCAGG - Intergenic
1202956920 15_KI270727v1_random:85143-85165 CCTAAATTCCTGCCTGTACCAGG + Intergenic
1138585762 16:57969717-57969739 CCTTAAGTACAGGTTGTTTCTGG + Intronic
1139669015 16:68479137-68479159 CCTTCAGTTCTGCCTGCAGCAGG + Intergenic
1154449624 18:14463378-14463400 CCTAAATTCCTGCCTGTACCAGG + Intergenic
1157204160 18:45684385-45684407 CCTTAAGTGCTGCATTTTTCTGG - Intergenic
1161578718 19:5068886-5068908 ACTTAATTACTGCCTGTAATTGG - Intronic
1166384391 19:42372151-42372173 CCTTCAGGACTGGCTATATCCGG + Intronic
1168598248 19:57696329-57696351 CCTTAAGACCTGCCTGGATCAGG + Intronic
933285351 2:80379164-80379186 TCTGAAATATTGCCTGTATCAGG + Intronic
935113046 2:100109304-100109326 CCTTTAGTACCGGCTGTATAAGG - Intronic
936122587 2:109759809-109759831 CCTTTAGTACCGGCTGTATAAGG + Intergenic
936222107 2:110611663-110611685 CCTTTAGTACCGGCTGTATAAGG - Intergenic
937729542 2:125211608-125211630 CCTAAAGTACTTCCTTTATTAGG - Intergenic
938157356 2:128952653-128952675 CCTCAGGTACTGCCTGAACCTGG + Intergenic
941787461 2:169513999-169514021 CTTTAACGCCTGCCTGTATCAGG + Intronic
945332782 2:208558806-208558828 CTTTAAGTACTGCTTTTATAAGG - Intronic
947358112 2:229318039-229318061 CCTCAAGTCATGCCTGTCTCTGG + Intergenic
1175666450 20:60864150-60864172 CCTCAAGTACTGGCTGACTCGGG - Intergenic
1176446547 21:6827011-6827033 CCTAAATTCCTGCCTGTACCAGG - Intergenic
1176824717 21:13692041-13692063 CCTAAATTCCTGCCTGTACCAGG - Intergenic
1179305816 21:40153295-40153317 CCTTCAGCACTGCAAGTATCAGG - Intronic
962157551 3:132964262-132964284 CCTTTAGTAATGCATGCATCTGG - Intergenic
962487571 3:135860182-135860204 CCTAAACTATTACCTGTATCCGG + Intergenic
962534031 3:136310687-136310709 TCTTAAGTACTACCTTTATCAGG - Intronic
963823341 3:149924059-149924081 CTTTAAATACTGGCTGTATCTGG + Intronic
966573403 3:181473057-181473079 TCTTAAGTCCTGCATGCATCAGG + Intergenic
967479435 3:189956924-189956946 TCTTGAATACTGCCTGCATCCGG - Exonic
989494316 5:42093930-42093952 CCTTAAGCTCTGCCTGTTTTAGG + Intergenic
992227741 5:74635309-74635331 ACTGAAGCACTGCCTGTATGTGG - Exonic
995419414 5:111946623-111946645 CCCTCAGTACAGCCTCTATCAGG + Intronic
998316977 5:141191636-141191658 CAATAAATACTGCCTGTATTAGG - Intronic
1002620529 5:180484960-180484982 CCCTAAAGGCTGCCTGTATCTGG + Intergenic
1004542860 6:16568398-16568420 CATTGAGAACTGCCTGTACCGGG - Intronic
1005260999 6:24059738-24059760 CTTTAATTATTGCCTGTGTCAGG + Intergenic
1011040437 6:83024434-83024456 CCATTAGAACTGCCTTTATCTGG - Intronic
1014104310 6:117545835-117545857 CCTGATGTACTACTTGTATCTGG + Intronic
1015134603 6:129853220-129853242 ACTTAAGTACTTCCTATTTCTGG + Intronic
1036576384 8:10031501-10031523 CCTTGAGTCCTACCTATATCTGG - Intergenic
1045663435 8:104461730-104461752 CCTCAATTTCTGCCTGTCTCTGG - Intronic
1045774278 8:105783607-105783629 CCTTAAGTACTTCATGTAAGTGG + Intronic
1046734797 8:117765722-117765744 ACTTAAGCACTGACAGTATCAGG + Intergenic
1050567812 9:6904759-6904781 CCTTTAGTAATGCCTTTCTCTGG + Intronic
1056991829 9:91420599-91420621 CTCTAACTACTGCCTGTAACAGG + Intronic
1058801163 9:108545657-108545679 CCTTTAGTAATGCTTGGATCTGG + Intergenic
1203522643 Un_GL000213v1:57520-57542 CCTAAATTCCTGCCTGTACCAGG + Intergenic
1193357600 X:80539677-80539699 CATTAAGTAATCCCTGAATCTGG - Intergenic
1197394005 X:125903550-125903572 CCTGAAGATCTGCCTGTGTCTGG + Intergenic
1197846384 X:130808273-130808295 CCTAATGTACTTCCTGTATTTGG - Intronic
1198790905 X:140344740-140344762 CAGTAAGAACTGCCTGTATTTGG + Intergenic
1201351865 Y:13052817-13052839 CCACTAGAACTGCCTGTATCTGG + Intergenic