ID: 1124680066

View in Genome Browser
Species Human (GRCh38)
Location 15:31723016-31723038
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124680066_1124680070 -1 Left 1124680066 15:31723016-31723038 CCAGCAGTCCTTCCTACTAGCTA 0: 2
1: 0
2: 2
3: 16
4: 228
Right 1124680070 15:31723038-31723060 AGGACAGTGATTCCACCATGAGG 0: 2
1: 0
2: 4
3: 45
4: 307
1124680066_1124680076 19 Left 1124680066 15:31723016-31723038 CCAGCAGTCCTTCCTACTAGCTA 0: 2
1: 0
2: 2
3: 16
4: 228
Right 1124680076 15:31723058-31723080 AGGACCATGGGGCAGAAGTCAGG 0: 2
1: 0
2: 3
3: 23
4: 274
1124680066_1124680072 7 Left 1124680066 15:31723016-31723038 CCAGCAGTCCTTCCTACTAGCTA 0: 2
1: 0
2: 2
3: 16
4: 228
Right 1124680072 15:31723046-31723068 GATTCCACCATGAGGACCATGGG 0: 2
1: 0
2: 0
3: 7
4: 73
1124680066_1124680071 6 Left 1124680066 15:31723016-31723038 CCAGCAGTCCTTCCTACTAGCTA 0: 2
1: 0
2: 2
3: 16
4: 228
Right 1124680071 15:31723045-31723067 TGATTCCACCATGAGGACCATGG 0: 2
1: 0
2: 2
3: 10
4: 173
1124680066_1124680078 26 Left 1124680066 15:31723016-31723038 CCAGCAGTCCTTCCTACTAGCTA 0: 2
1: 0
2: 2
3: 16
4: 228
Right 1124680078 15:31723065-31723087 TGGGGCAGAAGTCAGGAGAGTGG 0: 2
1: 1
2: 5
3: 74
4: 686
1124680066_1124680073 8 Left 1124680066 15:31723016-31723038 CCAGCAGTCCTTCCTACTAGCTA 0: 2
1: 0
2: 2
3: 16
4: 228
Right 1124680073 15:31723047-31723069 ATTCCACCATGAGGACCATGGGG 0: 2
1: 0
2: 1
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124680066 Original CRISPR TAGCTAGTAGGAAGGACTGC TGG (reversed) Intronic
901516493 1:9750586-9750608 TCGCTAGTAGCTGGGACTGCAGG - Intronic
902661846 1:17909842-17909864 TAGCCAGTAGGAGGCACTGTTGG - Intergenic
903574998 1:24334146-24334168 CAGCCAGTGGGAAGGACTGGAGG + Intronic
904698571 1:32344750-32344772 TAGCAAGTAGAGAGGAATGCTGG - Intergenic
905641783 1:39594997-39595019 TCCCGAGTAGGTAGGACTGCAGG - Intergenic
905685818 1:39907204-39907226 TCCCTAGTAGCTAGGACTGCAGG + Intergenic
907432891 1:54424245-54424267 TCCCGAGTAGGTAGGACTGCAGG + Intergenic
908535260 1:65070971-65070993 TAGTTAATAGGAAGCACTTCTGG + Intergenic
910326874 1:86019432-86019454 TCTCAAGTAGCAAGGACTGCAGG - Intronic
911221995 1:95258005-95258027 TAGTTATTAGGAAGGAATTCAGG + Intergenic
914849883 1:151306443-151306465 GAGCTAGGAGAAAGGACAGCAGG - Intronic
915576158 1:156779276-156779298 TCCCTAGTAGTTAGGACTGCAGG + Intronic
916604835 1:166330871-166330893 TACCCAGCAGGGAGGACTGCGGG - Intergenic
916892735 1:169128507-169128529 TGGCTAGTTTGATGGACTGCTGG + Intronic
917140560 1:171830976-171830998 TAGCCAGGAGGAAGGTCAGCAGG + Intergenic
918400845 1:184161474-184161496 AAGCTGGTAGAAAGGACTGTGGG - Intergenic
919474756 1:198019819-198019841 GAGATAGTAGGAAGGATTGCTGG - Intergenic
920451846 1:206065414-206065436 CAGCTAGAAGGCAGGACTCCAGG + Intronic
921182135 1:212639509-212639531 TAGCGAGTAGCAAGGACTACAGG - Intergenic
924073619 1:240309348-240309370 TAGCTAGTGGGCAGGCATGCAGG + Intronic
1063683331 10:8211660-8211682 TCCCTAGTAGATAGGACTGCAGG - Intergenic
1064056387 10:12101245-12101267 GAACAAGTAGGAAGGAGTGCTGG + Intronic
1064061008 10:12137162-12137184 TCCCTAGTAGGTAGGACTGCAGG + Intronic
1065838648 10:29681753-29681775 TAGCAAGGAGGAAGTCCTGCTGG - Intronic
1065992343 10:31024502-31024524 TCCCTAGTAGCTAGGACTGCAGG - Intronic
1069496831 10:68912336-68912358 TCTCCAGTAGGTAGGACTGCAGG + Intronic
1072257540 10:93634359-93634381 TAGCTAGAAGGGAGGAGTACAGG + Intronic
1072448583 10:95520505-95520527 TAGCTAGTAGCTGGGACTACAGG - Intronic
1073227175 10:101931657-101931679 TCCCTAGTAGCAAGGACTACGGG - Intronic
1073606717 10:104902863-104902885 TTGCTAGTAGGTAGGAGAGCAGG + Intronic
1073630075 10:105139573-105139595 TATCTGTTTGGAAGGACTGCTGG + Intronic
1074745143 10:116524705-116524727 TGGCTATTGGGAAGGACTTCTGG - Intergenic
1076110322 10:127855108-127855130 TGGCCAGGAGGAATGACTGCAGG - Intergenic
1077355408 11:2114529-2114551 AAGCTCGTGGGATGGACTGCAGG - Intergenic
1080147241 11:29001595-29001617 TTGCTATTAGGGAGGGCTGCAGG - Intergenic
1081453054 11:43192004-43192026 TTGCTAGTAGGAAGAACTCCAGG + Intergenic
1081895975 11:46586784-46586806 TAGCTAGTAAGCAGGGGTGCTGG + Intronic
1081932088 11:46878703-46878725 GAGCAAGTAGAAAGGACTGGAGG - Intronic
1083337599 11:61933819-61933841 TTCCTAGTAGCTAGGACTGCAGG - Intergenic
1083457743 11:62790276-62790298 TAGATAGGAGGAAGGAGTGAAGG + Exonic
1083674910 11:64319714-64319736 CACCTAGAAGGAAGGACTCCAGG - Exonic
1084101236 11:66951062-66951084 TAGCTCCAAGGGAGGACTGCGGG + Intronic
1084196870 11:67527786-67527808 TGGCTGGGAGGATGGACTGCTGG + Intergenic
1084867930 11:72075104-72075126 TATTTAGTAGGAAGGGCTTCAGG - Intronic
1085670312 11:78458022-78458044 TAGATAGGAGGAATGAGTGCTGG + Intronic
1086364283 11:86092366-86092388 TTCCTAGTAGCAAGGACTACAGG - Intergenic
1086788472 11:91003192-91003214 TACCTAGTAGCTAGGACTACAGG - Intergenic
1087601939 11:100328230-100328252 TCCCTAGTAGGTAGGACTACAGG - Intronic
1087799647 11:102489648-102489670 TACCTAGTAGATAGGGCTGCAGG + Intronic
1090034592 11:123237746-123237768 TATCTTGTAGGAAAGATTGCTGG + Intergenic
1091586665 12:1820827-1820849 TGGCTGGTAGGAAGGAATGGAGG + Intronic
1092447589 12:8571834-8571856 TACCTAGTAGCTAGGACTACAGG + Intergenic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1093963447 12:25301005-25301027 TCCCAAGTAGGTAGGACTGCAGG + Intergenic
1096381001 12:51158130-51158152 TAGCTAGTAGCTAGGACTACAGG + Intronic
1096757726 12:53814087-53814109 TTGCTATCGGGAAGGACTGCTGG + Intergenic
1096935090 12:55264971-55264993 TACCTAGTAGCTAGGACTGCAGG + Intergenic
1097716210 12:62969372-62969394 TTGATACTAGGAATGACTGCTGG - Intergenic
1097913829 12:64999125-64999147 TAGCTAGTAGGAAGGCATGAAGG - Intergenic
1099358575 12:81668628-81668650 CAGCTGGTAGGGAGTACTGCAGG - Intronic
1099895456 12:88640961-88640983 TAGCTAGAAGGAAAGATTTCTGG - Intergenic
1100464154 12:94830513-94830535 CAGCTAGTAAGTAGGAGTGCTGG - Intergenic
1101920899 12:108932137-108932159 CAGCTAGTAGCTAGGACTACAGG + Intronic
1102063534 12:109953494-109953516 TAGCTAGTAGCTGGGACTACAGG - Intronic
1103276922 12:119719665-119719687 TACCTAGGAGGAAGGAGTGGAGG - Intronic
1103999608 12:124852185-124852207 TAGCCAGAAGGAAGGGATGCGGG - Intronic
1104430858 12:128714836-128714858 CAGCTAGTAGGAAGGAAATCTGG + Intergenic
1105734258 13:23251480-23251502 CAGCTGGTAAGAAGGAATGCAGG + Intronic
1106183343 13:27386787-27386809 TGGATAGTAAGGAGGACTGCTGG + Intergenic
1108755640 13:53498675-53498697 TCTCAAGTAGGTAGGACTGCAGG - Intergenic
1109946373 13:69437640-69437662 TAGCAAATAGGAAGGACTGTAGG - Intergenic
1111627396 13:90807014-90807036 CAGCTGTTAGGCAGGACTGCAGG + Intergenic
1113105242 13:106764988-106765010 TGGCTATTAGGAAGGACAGGAGG + Intergenic
1113313526 13:109155404-109155426 TAACAAGTAGGAAGGAATGTCGG + Intronic
1118237419 14:64020847-64020869 AAGCTAGTAGGTAGTACAGCCGG - Intronic
1118238001 14:64028377-64028399 TACCTAGTAGCTAGGACTACAGG + Intronic
1118782577 14:69018822-69018844 AAGCCAGTGGGTAGGACTGCTGG + Intergenic
1119532665 14:75373918-75373940 TAGCTAGTAGGATGAAGTGAAGG + Intergenic
1119752254 14:77087893-77087915 TACCCAGAAGGAAGGAGTGCAGG - Intergenic
1120440681 14:84534855-84534877 TAGCTAGTGGGAACCACTGCAGG - Intergenic
1120939079 14:89929175-89929197 TAGCTAGCAGCTAGGACTACAGG + Intronic
1121558660 14:94857892-94857914 TAGCTAGCAGGAGGGCCTCCAGG + Intergenic
1122340995 14:101028437-101028459 CAGCTAATAGGAAGGATTGGTGG - Intergenic
1123491745 15:20786516-20786538 TAGCTGGTAGCTGGGACTGCAGG + Intergenic
1123548247 15:21355610-21355632 TAGCTGGTAGCTGGGACTGCAGG + Intergenic
1124138805 15:27059207-27059229 TAGCCAGCAGGAAGGCCTGAAGG + Intronic
1124551178 15:30682638-30682660 TAGCTAGTAGGAAGGACTGCTGG + Intronic
1124680066 15:31723016-31723038 TAGCTAGTAGGAAGGACTGCTGG - Intronic
1125649043 15:41298393-41298415 TAGCAAGTATGAATGACTTCAGG + Intergenic
1202956579 15_KI270727v1_random:82840-82862 TAGCTGGTAGCTGGGACTGCAGG + Intergenic
1134174308 16:11993428-11993450 TAGCTAGTTGAAAGGACTTCTGG + Intronic
1134181039 16:12047972-12047994 TAGCTAGTAGGTGGCAGTGCCGG + Intronic
1134664513 16:16009078-16009100 TAGCTGGTAGCTGGGACTGCAGG + Intronic
1135307776 16:21381724-21381746 TAGCTAGTAGGTGGCAGTGCTGG + Intergenic
1136304520 16:29360844-29360866 TAGCTAGTAGGTGGCAGTGCTGG + Intergenic
1137001695 16:35235006-35235028 CAGCTAGTTGGAAGGAAAGCAGG + Intergenic
1137897385 16:52228780-52228802 TAGCTTATAGAAAGGCCTGCTGG + Intergenic
1138256960 16:55573808-55573830 TAGAAAGTAGGGAGGACTGAAGG - Intronic
1138612704 16:58139806-58139828 TTCCTAGTAGCAAGGACTACAGG + Intergenic
1139731178 16:68946623-68946645 TAGCAAGTAGCCAGGACTACAGG + Intronic
1139760417 16:69180358-69180380 TACCTAGTAGCTAGGACTACAGG + Intronic
1141071929 16:80964820-80964842 TACCTAGTAGCTAGGACTACAGG + Intergenic
1144614846 17:16759606-16759628 AAGCTGGTAGGAAGGGCTCCAGG - Intronic
1145095750 17:20024623-20024645 TGGCTAGTAGGAAGCACTAGTGG + Intronic
1146206786 17:30911823-30911845 TCCCTAGTAGGTAGGACTACAGG - Intronic
1146691770 17:34881778-34881800 TAGCTATGAGGAAGGGCTGATGG + Intergenic
1147841130 17:43372291-43372313 GAGATAGTAGGAAAGACAGCTGG + Intergenic
1149612034 17:57964932-57964954 TAAATGGTAGAAAGGACTGCCGG + Intergenic
1149778725 17:59379120-59379142 TAGCTAAGAGGAAAGACTGAAGG - Intronic
1150848200 17:68680352-68680374 TCTCAAGTAGGTAGGACTGCAGG + Intergenic
1155156896 18:23165194-23165216 TAGCTACTTGGGAGGATTGCTGG - Intronic
1155483237 18:26312457-26312479 TAGATAGAAGGAAGGATGGCAGG + Intronic
1157583547 18:48787183-48787205 TCGCAAATAGTAAGGACTGCGGG - Intronic
1157642069 18:49226300-49226322 TACCATGTAGGAAGGAATGCTGG - Intronic
1158175911 18:54655452-54655474 TCCCTAGTAGGTAGGACTGTAGG + Intergenic
1161184548 19:2907829-2907851 TCCCTAGTAGCTAGGACTGCAGG + Intronic
1161546336 19:4882765-4882787 TAGCTAGTAGCTAGGATTACAGG - Intergenic
1164133567 19:22388740-22388762 TCCCTAGTAGGAAGGACTACAGG - Intergenic
1164165241 19:22668015-22668037 TCCCTAGTAGGTAGGACTACAGG + Intergenic
1166357175 19:42234039-42234061 CAGCTAGGGGGAAGGGCTGCTGG - Intronic
1166801122 19:45457837-45457859 GAGGCAGCAGGAAGGACTGCAGG - Intronic
1167117684 19:47497676-47497698 TCGCTGGTAGGAGTGACTGCGGG - Intronic
925865671 2:8223976-8223998 CAGCAAGTAGGAGGGACTGCTGG - Intergenic
926199693 2:10785834-10785856 TCCCTAGTAGCTAGGACTGCAGG + Intronic
926646637 2:15296713-15296735 TCCCTAGTAGGTAGGACTACAGG - Intronic
930406894 2:50970030-50970052 TACCCAGAAGGAAGGAATGCAGG - Intronic
932092381 2:68817810-68817832 TAGCCAGGAGGAAGCACTACAGG - Intronic
932722225 2:74146678-74146700 GAGCTATCAGGAAGGACTGAGGG - Intronic
932940769 2:76162265-76162287 TAGCTACCTGGGAGGACTGCTGG + Intergenic
934048925 2:88194033-88194055 TTGTTAGTAGCTAGGACTGCAGG + Intergenic
935143762 2:100379597-100379619 TACCTGGTAGCTAGGACTGCAGG - Intergenic
935929003 2:108103151-108103173 TTGCTAGTAGAAAGAACTTCGGG - Intergenic
938077687 2:128348507-128348529 TAGCAGGGAGGAAGGCCTGCTGG - Intergenic
939723699 2:145687541-145687563 TAGCTTGAAGGAAGGAATGAGGG + Intergenic
940218671 2:151327990-151328012 TCCCTAGTAGCTAGGACTGCAGG - Intergenic
941442135 2:165551556-165551578 TAGCTATTAGCAAGATCTGCAGG - Intronic
941534981 2:166711194-166711216 TACCTAGTAGGTGGGAGTGCAGG + Intergenic
943204006 2:184867491-184867513 TAGTTGGTATGAACGACTGCAGG - Intronic
944762791 2:202834502-202834524 TCCCTAGTAGCAGGGACTGCAGG - Intronic
946028017 2:216683859-216683881 GAGCCAGTGGGAAGGACTGGAGG - Intronic
947706688 2:232282060-232282082 AAGCAAGGAGGAAGGACGGCTGG - Intronic
948150924 2:235744218-235744240 TAGCGAGTGGGAAGGACTGAGGG + Intronic
1168737624 20:156591-156613 TAGATAGGAGGAATGACTTCTGG - Intergenic
1170356172 20:15494305-15494327 TATCCAGGAGGAAGGGCTGCTGG - Intronic
1170580047 20:17692102-17692124 TAGCTGGCAGAAGGGACTGCAGG - Intergenic
1172196197 20:33093347-33093369 TAGATAGATGGAAGGACTGGTGG - Intronic
1172333199 20:34090870-34090892 TAGCAAGTAGCTAGGACTACAGG + Intronic
1173656555 20:44703820-44703842 TAGCCAGTAGGAAGCAGAGCTGG - Intergenic
1174024881 20:47565759-47565781 TAGCTAGTAATTAGGACAGCTGG + Intronic
1175234784 20:57502291-57502313 GAGGGAGTGGGAAGGACTGCAGG + Intronic
1175738399 20:61403343-61403365 TACTCAGTATGAAGGACTGCAGG - Intronic
1180785549 22:18545347-18545369 CAGCTAGTAGGTGGGACTACAGG + Intergenic
1181129135 22:20719387-20719409 CAGCTAGTAGGTGGGACTACAGG + Intronic
1181242455 22:21484699-21484721 CAGCTAGTAGGTGGGACTACAGG + Intergenic
950855349 3:16099445-16099467 TAGCCAGCAGGCAGGCCTGCAGG + Intergenic
952474041 3:33686835-33686857 TGGCTAGTAGTAAGGACAGATGG - Intronic
953351945 3:42222504-42222526 TAGGTACTAAGAAGGAATGCTGG + Intronic
953630821 3:44615294-44615316 TAGATAGGAGGAAGGAGTTCTGG + Intronic
954323396 3:49847256-49847278 TACCTAGTAGCTAGGACTGTAGG - Intronic
954654546 3:52186028-52186050 TAGCTAGGGGGAAGCACTGAGGG + Intergenic
955639192 3:61063972-61063994 TAGCAAGGATGAAGGACTGATGG - Intronic
957333348 3:78794704-78794726 TACCGAGTAGCTAGGACTGCAGG + Intronic
958650749 3:96932656-96932678 TGGTTAGTAGGAAGGAAAGCAGG + Intronic
958673012 3:97228732-97228754 TACCTAGTAGGGGGGATTGCTGG + Intronic
960462376 3:117952142-117952164 TAGCTAGTAGGTAGGACTACAGG + Intergenic
960607481 3:119522037-119522059 TACCTAGTAGGGAAGATTGCTGG - Intronic
961044598 3:123699878-123699900 TAGCAGGTAGGAGGGCCTGCTGG - Intronic
962621172 3:137181302-137181324 GAGCCAGTAGGAGGGACTGGAGG - Intergenic
963142811 3:141961812-141961834 TTCCTAGTAGCCAGGACTGCAGG - Intronic
963613833 3:147508684-147508706 TCTCTGGTAGCAAGGACTGCAGG - Intronic
963772354 3:149400503-149400525 TAGATAGAAGGAAGGAATTCTGG + Intergenic
963867608 3:150379323-150379345 TAGCAAGTAGCTGGGACTGCAGG + Intergenic
965044628 3:163560636-163560658 TAGCAAGTAGGTAAGCCTGCAGG + Intergenic
966235352 3:177695490-177695512 GAGCTTGTAGGAAGGCCGGCTGG + Intergenic
966347372 3:178994281-178994303 AAGCTATTAGGAAGAGCTGCAGG - Intergenic
966421308 3:179737138-179737160 CAGCTAGTAGGATGGACTCAGGG + Intronic
970515163 4:16821875-16821897 GAGCTGGAAGGAAGGACTCCTGG + Intronic
970725934 4:19044875-19044897 TAGCGAGTAGCTGGGACTGCAGG - Intergenic
970871729 4:20823977-20823999 TAGCTAGGAGGTAGCAGTGCTGG - Intronic
971339540 4:25755205-25755227 TCCCTAGTAGCCAGGACTGCAGG + Intronic
972312426 4:37893248-37893270 GAGAGAGTAGGAAGGACTTCAGG - Intronic
973068156 4:45822763-45822785 TATCCAGTAGTAAGGATTGCTGG - Intergenic
973820972 4:54660998-54661020 TAGCTTGGAGGAAGGGCTGTAGG + Intronic
976226772 4:82800354-82800376 CAGGGAGTAGGAAGGTCTGCTGG - Intergenic
976785484 4:88814961-88814983 CAGCTTGTAGGTAGGACTACAGG + Intronic
976895791 4:90109238-90109260 CAGCTCGTAGGAAGGTCTCCGGG - Intergenic
977578729 4:98701953-98701975 TAGCTAGTAGGCAGTAGAGCTGG + Intergenic
978835181 4:113140852-113140874 TCCCAAGTAGCAAGGACTGCAGG - Intronic
979005778 4:115295414-115295436 CAGCAAGTAGGAGGGAATGCTGG + Intergenic
979928354 4:126596352-126596374 TCCCTAGTAGCTAGGACTGCAGG - Intergenic
980353005 4:131706568-131706590 TACCAAGTAGGCAGGATTGCAGG + Intergenic
981051200 4:140311103-140311125 TAGTTAGTAGTTAGGACTGCAGG - Intronic
981702571 4:147622884-147622906 TTCCTAGTAGGTAGGACTACAGG + Intronic
983441160 4:167786773-167786795 TAGATAGTAGGGAGAACTGATGG + Intergenic
988676470 5:33438425-33438447 TCCCAAGTAGGTAGGACTGCAGG - Intergenic
989004366 5:36793641-36793663 TCCCGAGTAGGTAGGACTGCAGG - Intergenic
991680198 5:69132361-69132383 TCTCCAGTAGGTAGGACTGCAGG + Intergenic
991860640 5:71010229-71010251 TCGCAAGTAGCTAGGACTGCAGG + Intronic
992174083 5:74132809-74132831 TAGCCAGTAGGAAGGAATTAAGG - Intergenic
997551293 5:134755454-134755476 TAGCTAGTAGCTGGGACTACAGG - Intergenic
999306174 5:150521075-150521097 TGGCTGGGAGGAAGGACTGGGGG + Exonic
999496925 5:152108190-152108212 TAGATTGTAGGAAGGAAGGCTGG + Intergenic
999864375 5:155684685-155684707 TATCTTGTAGGAAGGACTGCAGG + Intergenic
1007024370 6:38555097-38555119 TATCTTGGAGAAAGGACTGCAGG - Intronic
1007103358 6:39266904-39266926 TACCCAGAAGGAAGGAATGCAGG - Intergenic
1007145476 6:39625683-39625705 AAGGTAGTAGTAAGGACTGAAGG + Intronic
1007459359 6:42006454-42006476 CAGCTAGAAGCAAGGACAGCAGG - Intronic
1008538606 6:52527252-52527274 TCCCGAGTAGCAAGGACTGCAGG - Intronic
1008551158 6:52632511-52632533 TAGCAAGTAGCTAGGACTACAGG + Intergenic
1009670632 6:66744849-66744871 TAGATAGTAGGAATGATTTCTGG - Intergenic
1011211609 6:84961473-84961495 TCCCGAGTAGCAAGGACTGCAGG + Intergenic
1013116320 6:107106326-107106348 CAGGGAGTAGGAAGGACTTCAGG + Intronic
1014079561 6:117270936-117270958 GAGCTCGCAGGGAGGACTGCCGG - Exonic
1017822366 6:158059051-158059073 TAGCTAGTAGTAATGGCAGCTGG + Intronic
1022297265 7:29067926-29067948 TGGCAAGTAGGAAGCATTGCAGG - Intronic
1023503715 7:40878141-40878163 GAGGTAGTAGAAAGGACTGCTGG - Intergenic
1028051075 7:86187110-86187132 TCTCTAGTAGCTAGGACTGCAGG - Intergenic
1028298319 7:89163922-89163944 TATCTAGTGGGAAGGAATGGAGG - Intronic
1030664343 7:112257935-112257957 TTCCAAGTAGGTAGGACTGCAGG + Intronic
1033202497 7:139385443-139385465 TCCCAAGTAGCAAGGACTGCAGG + Intronic
1036126097 8:6063874-6063896 GAGCTAGCAGGAAGCACTGGAGG - Intergenic
1040662117 8:49585391-49585413 TACCTAGTAGCTGGGACTGCAGG - Intergenic
1044737771 8:95296821-95296843 TAGCCTGAAGGAAGGAATGCTGG - Intergenic
1045662506 8:104452715-104452737 TACCAAGTAGCTAGGACTGCAGG - Intronic
1050244496 9:3673613-3673635 TAGGTAGTAGGTAAGAGTGCAGG + Intergenic
1050993978 9:12190316-12190338 TAGCCAATTGGAAGCACTGCAGG + Intergenic
1051956324 9:22699430-22699452 TAGCTAATATGAATGCCTGCTGG - Intergenic
1052825409 9:33170530-33170552 TAGCCAGGAGACAGGACTGCGGG + Intergenic
1055237167 9:74137027-74137049 TAGCTAGTAAGCAGGAGAGCTGG - Intergenic
1056228144 9:84516952-84516974 TAGTGAGGAGGAAAGACTGCTGG + Intergenic
1057125492 9:92612908-92612930 CAGCTAGTCGGGAGGAGTGCGGG + Intronic
1057881837 9:98797720-98797742 TACCGAGTAGCTAGGACTGCAGG + Intergenic
1058081007 9:100701007-100701029 GAGCTAGTAAGAAGCAATGCTGG - Intergenic
1061057064 9:128229269-128229291 TCCCAAGTAGCAAGGACTGCAGG - Intronic
1062639657 9:137512067-137512089 GAGATAGTAGGAAAGACAGCTGG - Intronic
1185469257 X:373034-373056 TAGCCAGTGGGAAGGAATGCTGG + Intronic
1185892320 X:3832684-3832706 TCGCTAGTAGCTAGGATTGCAGG + Intronic
1185897428 X:3871103-3871125 TCGCTAGTAGCTAGGATTGCAGG + Intergenic
1185902547 X:3909535-3909557 TCGCTAGTAGCTAGGATTGCAGG + Intergenic
1187443321 X:19339374-19339396 TCCCTAGTAGCTAGGACTGCTGG + Intergenic
1189067774 X:37829420-37829442 TACCTAGTAGTTAGGACTACAGG + Intronic
1191795338 X:65015945-65015967 AAGCTAGTAGGAAGGAATTGGGG - Intronic
1192965883 X:76176275-76176297 TCCCTAGTAGGTGGGACTGCAGG + Intronic
1195054563 X:101131111-101131133 TAGTTAGTAGCTAGGACTACAGG + Intronic
1195773536 X:108377816-108377838 TCGCTAGTAGCTAGGACTACAGG - Intronic
1196349461 X:114708681-114708703 TACCTAGTAGGTAGGACTAAAGG - Intronic
1197347186 X:125337911-125337933 CAGGTGGTAGGAAGAACTGCAGG + Intergenic
1198740143 X:139833564-139833586 TCCCTAGTAGGTAGGACTACAGG - Intronic