ID: 1124684246

View in Genome Browser
Species Human (GRCh38)
Location 15:31766923-31766945
Sequence GCACCTTGGTTTGCTGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124684241_1124684246 10 Left 1124684241 15:31766890-31766912 CCCTGACACATCTACAATTCCTT 0: 2
1: 1
2: 0
3: 16
4: 182
Right 1124684246 15:31766923-31766945 GCACCTTGGTTTGCTGTTAGAGG 0: 2
1: 0
2: 1
3: 7
4: 108
1124684240_1124684246 26 Left 1124684240 15:31766874-31766896 CCTCTTTACTTGAATTCCCTGAC 0: 2
1: 1
2: 2
3: 7
4: 161
Right 1124684246 15:31766923-31766945 GCACCTTGGTTTGCTGTTAGAGG 0: 2
1: 0
2: 1
3: 7
4: 108
1124684243_1124684246 -9 Left 1124684243 15:31766909-31766931 CCTTCCAAAGAATAGCACCTTGG 0: 1
1: 1
2: 1
3: 13
4: 134
Right 1124684246 15:31766923-31766945 GCACCTTGGTTTGCTGTTAGAGG 0: 2
1: 0
2: 1
3: 7
4: 108
1124684242_1124684246 9 Left 1124684242 15:31766891-31766913 CCTGACACATCTACAATTCCTTC 0: 2
1: 1
2: 0
3: 16
4: 157
Right 1124684246 15:31766923-31766945 GCACCTTGGTTTGCTGTTAGAGG 0: 2
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124684246 Original CRISPR GCACCTTGGTTTGCTGTTAG AGG Intronic
900157535 1:1209223-1209245 GCACCTTGGGCTGTTGTGAGTGG + Intergenic
905977548 1:42188645-42188667 CCAACTTGGTTTGCTGCTAATGG - Intronic
906288906 1:44606662-44606684 GAACCTTCGTTTACAGTTAGAGG - Intronic
906305543 1:44716339-44716361 CCTCCTTGGCTTGCTGTGAGGGG - Intronic
906952596 1:50346959-50346981 GCAAGTTGGTTTCCTGTTTGTGG - Intergenic
907029930 1:51161008-51161030 GAACCCTTGTATGCTGTTAGTGG + Intergenic
908789706 1:67769632-67769654 GCACGTTGGTATGCAGGTAGAGG + Intronic
908860576 1:68482548-68482570 GCACCTTGGTTTGCTGTTAGAGG + Exonic
910096236 1:83525341-83525363 GCACCTTGTTTTGCTCTTTCTGG + Intergenic
911262544 1:95702707-95702729 GCACCTAGGTTTGCAGTAATGGG - Intergenic
911622880 1:100086884-100086906 GCACCTTGAATTCCTGTTAATGG - Intronic
923042415 1:230328689-230328711 GCACCTTCCTCGGCTGTTAGTGG + Intronic
1067655511 10:48188600-48188622 GCACCTTGGTTGGCTCTAGGAGG - Intronic
1073082437 10:100868541-100868563 GCAGCTTTATTTGCTGTCAGTGG + Intergenic
1075642740 10:124076488-124076510 TCACCTTGGTGTGCTGGGAGGGG - Intronic
1075732402 10:124644349-124644371 GCTCCTAGGTTTGCTGGCAGAGG - Intronic
1076411787 10:130256826-130256848 GCCCCTTGGTGTGGTGTTTGTGG - Intergenic
1081945646 11:46991266-46991288 TCACCTTGGGTTTCTGTTAGGGG + Intronic
1083316840 11:61820568-61820590 GCACCTTGGTTTGGAGTTCTAGG + Intronic
1084321782 11:68377339-68377361 GCACCTTGGCCTGCAGTCAGGGG - Intronic
1085228194 11:74941731-74941753 GCAACTGGGATTGCAGTTAGGGG + Intronic
1089386466 11:118071448-118071470 GCACCTTGGCTCACTGTGAGGGG - Intergenic
1089424068 11:118356250-118356272 GCACTTTTGTTTGTTGTTATTGG - Intergenic
1093443952 12:19232746-19232768 TCATCTTGGTTTTCTTTTAGAGG - Intronic
1102661158 12:114529812-114529834 GCAACTTGTTTTACTTTTAGGGG - Intergenic
1107578593 13:41755222-41755244 GAACCCTTGTATGCTGTTAGTGG - Intronic
1107835479 13:44409580-44409602 CCACCTTGTTCTGCTGTTCGTGG - Intergenic
1112192554 13:97192085-97192107 GCAGCTTGGTTGGCCTTTAGAGG + Intergenic
1113401761 13:110000922-110000944 TCACCCAGGTTTGCTGTTTGTGG + Intergenic
1115783497 14:36798120-36798142 GCGCCTTGGTGTCCTCTTAGTGG + Intronic
1118099329 14:62578588-62578610 GAACCCTTGTATGCTGTTAGTGG + Intergenic
1118632437 14:67718103-67718125 CCATTTTGGTTTGCTGTTTGGGG + Intronic
1119753640 14:77098536-77098558 GGGCTTTGGTTTGCTGTGAGGGG + Intronic
1124684246 15:31766923-31766945 GCACCTTGGTTTGCTGTTAGAGG + Intronic
1125170997 15:36766518-36766540 GAACCTTTGTATGCTGTTGGAGG - Intronic
1125245447 15:37631636-37631658 ACAACTTGCTTTGCTGTTTGAGG - Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1138517266 16:57543049-57543071 GCACCTTGGATGGCTGTCAGGGG + Exonic
1139609144 16:68042477-68042499 GAAGCTTTGTGTGCTGTTAGTGG - Intronic
1140663105 16:77206881-77206903 GCACCTTGCTTTGCTTTTTGCGG + Intronic
1144378475 17:14669205-14669227 GCACCTGGATTTGTTGTAAGGGG - Intergenic
1145089541 17:19975536-19975558 GCATTTTGGTTAGATGTTAGAGG - Intronic
1147187027 17:38718483-38718505 GTACCCTGGTTTGCTGTGTGTGG - Intronic
1148072238 17:44915198-44915220 GCGCCTTGTTTTGCTGTTCCAGG + Exonic
1148230409 17:45929865-45929887 TAACCTTTGTTTGCTGTTAGTGG + Intronic
1150935598 17:69631952-69631974 GAACCCTGGTATACTGTTAGTGG + Intergenic
1156410974 18:36828432-36828454 GGACCTTGGTTGGCGGTGAGTGG + Intronic
1156783708 18:40882698-40882720 GCACCTTGCCTTGCTGCTGGAGG - Intergenic
1157454069 18:47810520-47810542 GGACCTTGATTTGCTGTCACAGG - Exonic
1158978169 18:62731699-62731721 GCAACTTGGTTAACTGTTTGTGG - Intronic
1159329906 18:66979034-66979056 TCACATTAGTTTGCTCTTAGAGG + Intergenic
1162040332 19:7967279-7967301 GCACCTTGGGTGGCTGAGAGAGG - Intronic
1164033546 19:21433274-21433296 GGACCTTGGTTTGGTTTAAGAGG + Intronic
1167710873 19:51109691-51109713 GCATCATGGTTTCCTGTTATGGG - Intergenic
1167999701 19:53435131-53435153 GGACCTTGGTTTGGTTTAAGAGG + Intronic
1168004132 19:53472456-53472478 GGACCTTGGTTTGGTTTAAGAGG + Intronic
927017837 2:18985133-18985155 GAACCCTTGTGTGCTGTTAGCGG - Intergenic
928012424 2:27622344-27622366 GCACCTTGGTTTTCCCTTAGTGG - Exonic
931078232 2:58740525-58740547 CCACCTGGGTTTCCTGTCAGAGG + Intergenic
932263961 2:70350818-70350840 GAACCCTGGTATGCTGTTGGTGG - Intergenic
932796273 2:74698842-74698864 GGGCATTGGTTTGCTGTTGGGGG - Intergenic
932904800 2:75738341-75738363 GCAGCTTGGTTTGCAGTGGGCGG - Intergenic
936492467 2:112984003-112984025 GCTCCTGGGTTAGATGTTAGGGG + Intronic
937915291 2:127095940-127095962 TCACCTTGTTTTGCTGAGAGAGG + Intronic
939459503 2:142481186-142481208 ACAGCTTGGTATGCTGTTATTGG + Intergenic
944346645 2:198673910-198673932 GCACCTGGGATTGCTGGTAGAGG + Intergenic
944578269 2:201110873-201110895 GCACCTTGCTTTGCTTGTAAAGG + Intergenic
946549305 2:220783125-220783147 GTCCCTTCGTTTTCTGTTAGGGG + Intergenic
947514647 2:230791669-230791691 ACACCTGGGTTTGCTGTAGGTGG + Intronic
1169216703 20:3798376-3798398 GCACCTTGGTTTGAAAGTAGTGG - Intronic
1169931950 20:10843167-10843189 ACAGCTTGGTTTGCTGTGTGGGG + Intergenic
1170626186 20:18031854-18031876 GAAGCTTGATTTGCTATTAGGGG - Intronic
1172413334 20:34742720-34742742 GCACCTTGAGTTGCTGAAAGGGG + Exonic
1176079630 20:63265743-63265765 ACACCTTGGTCTTCTGCTAGGGG + Intronic
1180929701 22:19580865-19580887 GAACGTTGGTTTACTGTTGGTGG + Intergenic
1185231669 22:49687415-49687437 GCAGATTGGGGTGCTGTTAGGGG - Intergenic
949676878 3:6465152-6465174 CATCCTTGGTTTGCTTTTAGAGG - Intergenic
952410645 3:33047007-33047029 GCAGCTGGGTTGGCTGTTCGAGG - Intronic
952877063 3:37954956-37954978 GCACCTTTGCTTGCTCATAGTGG + Intronic
956112612 3:65884817-65884839 GGAATTTGGTTTTCTGTTAGAGG + Intronic
960425660 3:117504941-117504963 ACAACTTGGTTTGTTGTTATTGG + Intergenic
963784212 3:149516307-149516329 GCACATTGGTTTGCAGTTTGAGG - Intergenic
972231514 4:37077987-37078009 GAACACTGGTTTGCTCTTAGTGG - Intergenic
974894718 4:67925621-67925643 GGACCATCGATTGCTGTTAGTGG + Intronic
975979259 4:80137724-80137746 GCACTTTGATTTTCTGTAAGAGG + Intergenic
980104587 4:128575702-128575724 GCACCTTGCTTCTCTTTTAGGGG - Intergenic
982507343 4:156237143-156237165 GCACTTAGGTTTGCTTTTTGGGG + Intergenic
987605578 5:20131508-20131530 GCAATTTGTTTTGCTTTTAGTGG - Intronic
990603915 5:57388186-57388208 CCACCTTGTTTTATTGTTAGAGG - Intergenic
993431793 5:87841365-87841387 GCACTTGGGGTTGCTGTCAGTGG + Intergenic
998153705 5:139772020-139772042 TCTCCTTGGCTTGCTCTTAGGGG + Intergenic
1001399707 5:171439241-171439263 GCACCTTGGTATTCTGCAAGAGG + Intronic
1002348056 5:178561692-178561714 GCTCTTTGTTTTGCTTTTAGGGG - Intronic
1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG + Intergenic
1007676759 6:43602178-43602200 ACACCTTGATATGCTATTAGAGG - Intronic
1008293987 6:49754895-49754917 AGACCTTGGTTTGCTTTTATTGG + Intergenic
1011747742 6:90422841-90422863 TCACATTGGTTTGGTTTTAGTGG + Intergenic
1011783980 6:90823619-90823641 GAACATTGATTTGCTGTTATTGG - Intergenic
1013301390 6:108808250-108808272 GCAGCATGATTTGTTGTTAGGGG + Intergenic
1017561728 6:155635506-155635528 GCTCTTAGGTTTGCTGTCAGTGG + Intergenic
1020447464 7:8284086-8284108 GGAACTTGGTCTGCTGGTAGTGG + Intergenic
1026531587 7:71203260-71203282 GAACCCTGGTATGCTGTTGGTGG - Intronic
1033365119 7:140667196-140667218 GGACCTTGGTTTGGTTTAAGAGG - Intronic
1034708674 7:153171105-153171127 GCACCGGATTTTGCTGTTAGGGG + Intergenic
1035580473 8:737022-737044 CCGCCTGGGTTTGCTGTGAGTGG - Intronic
1040401640 8:47056096-47056118 GAACCTTGGTTTCCAGTTTGGGG - Intergenic
1051313266 9:15800227-15800249 GAACCTTTGTATGCTGTTGGTGG - Intronic
1052273623 9:26653689-26653711 GCAGCTTGGTTTCATGTTAACGG - Intergenic
1057525533 9:95796244-95796266 GCTCCCTGGTGTGCTGTGAGAGG + Intergenic
1058056409 9:100453529-100453551 GCACCTTGCTCTACTGTTAATGG + Intronic
1058514782 9:105759551-105759573 GCAACTTGGTTTGCTATTAGAGG - Intronic
1059754260 9:117277455-117277477 GAACCTTGGTGCCCTGTTAGTGG + Intronic
1061647484 9:132016959-132016981 CCACCTATGTGTGCTGTTAGAGG - Intronic
1062527896 9:136985626-136985648 GCTCCTTGTTTTGCAGTGAGGGG + Exonic
1187632070 X:21184208-21184230 GAACCCTGGTATGCTGTTGGTGG - Intergenic
1194477231 X:94373279-94373301 GAACCTTTGTGCGCTGTTAGTGG + Intergenic
1196535974 X:116844945-116844967 GCACATTGGTCTGCTGCTAATGG + Intergenic
1196742935 X:119041184-119041206 CCACCTGGGTGTGCTGTTTGGGG - Intergenic