ID: 1124685716

View in Genome Browser
Species Human (GRCh38)
Location 15:31780059-31780081
Sequence GGGTGATTAACCAACAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124685713_1124685716 -5 Left 1124685713 15:31780041-31780063 CCAAGAAGAGAGTGCCTGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 87
1124685708_1124685716 22 Left 1124685708 15:31780014-31780036 CCAAGGAGGGAGCATGTCATCCT 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 87
1124685707_1124685716 25 Left 1124685707 15:31780011-31780033 CCTCCAAGGAGGGAGCATGTCAT 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 87
1124685709_1124685716 2 Left 1124685709 15:31780034-31780056 CCTCAAACCAAGAAGAGAGTGCC 0: 1
1: 0
2: 1
3: 21
4: 196
Right 1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 87
1124685706_1124685716 26 Left 1124685706 15:31780010-31780032 CCCTCCAAGGAGGGAGCATGTCA 0: 1
1: 0
2: 1
3: 23
4: 213
Right 1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124685716 Original CRISPR GGGTGATTAACCAACAAGGA TGG Intronic
900621758 1:3590750-3590772 GGGTGATGGAGAAACAAGGAAGG + Intronic
904574323 1:31493464-31493486 GGGTGACTAGCCAACAATGGGGG - Intergenic
906002192 1:42436181-42436203 GGGTGATTAACGAATAATGAAGG - Intronic
913319020 1:117575820-117575842 GGGAGATTAACCACCAGGGAGGG + Intergenic
917139318 1:171818887-171818909 GGGTGGTGAACTAACCAGGAGGG - Intergenic
921674156 1:217959471-217959493 GGCTGATTAAACAAAAACGAGGG + Intergenic
922459859 1:225807687-225807709 GGATGATTAACCAAGTAGGAGGG + Intergenic
924915698 1:248566109-248566131 GTGGGATTAACCAAGAAGCAAGG - Intergenic
1069542647 10:69306993-69307015 GGGTGAATAAATGACAAGGAGGG + Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1078573956 11:12483110-12483132 GGGTGATTTTCCTGCAAGGAAGG - Intronic
1078872635 11:15363215-15363237 GAGTGATTAATCAAAAAGCATGG - Intergenic
1079997173 11:27306326-27306348 GGGAGATAAACCAACAAAGCTGG - Intergenic
1086980525 11:93192331-93192353 GTGTGCTTAAGGAACAAGGAGGG + Intronic
1087818409 11:102684429-102684451 GGGTAATTTACAAACAAAGAAGG + Intergenic
1088175450 11:107048370-107048392 AGGGGATAAATCAACAAGGAGGG - Intergenic
1088541550 11:110918970-110918992 GGCTCATTTACCCACAAGGATGG - Intergenic
1092452884 12:8619399-8619421 GGGTCATTAATTAACAAGGCAGG - Intergenic
1095935347 12:47674265-47674287 GGGAGATTAAACCACAAAGATGG + Intronic
1096452669 12:51757095-51757117 GGTTGGTTACCCAACCAGGAGGG - Intronic
1100437838 12:94588249-94588271 GGGAGATGAACCAAAAAGGAAGG + Intronic
1108263425 13:48680522-48680544 TGGTAATTAAACAACAAAGAAGG - Intronic
1110184925 13:72662292-72662314 AGGAAATTAACCAACAAGGATGG - Intergenic
1113799196 13:113077796-113077818 GTGTGAGAAACCAGCAAGGATGG - Intronic
1116403803 14:44543074-44543096 CAGTGATTAACAAAGAAGGAAGG - Intergenic
1116806267 14:49496579-49496601 GGATGATTAAATAACAATGAAGG + Intergenic
1118919103 14:70133621-70133643 GGGTGAAAAACCATCAAGGGTGG - Intronic
1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG + Intronic
1130087067 15:80786667-80786689 GTGTGATAATCCAACAAAGATGG + Intronic
1132337225 15:101055850-101055872 GGGTGATCAATTAACAAGGCTGG - Intronic
1139118247 16:63983497-63983519 GGGTGATTAGCTACCAAGGGTGG - Intergenic
1141197211 16:81868958-81868980 GGGTGATGCCCCAATAAGGAGGG - Intronic
1147118726 17:38322388-38322410 GGGTGATGCACCACCCAGGAAGG + Intronic
1152687010 17:81699416-81699438 AGAAGATAAACCAACAAGGATGG - Intronic
1155153160 18:23137489-23137511 GCCTTATTAACCAACAAGGGAGG - Intronic
1155528192 18:26738888-26738910 GGATGATAAACCAACAAAAAAGG + Intergenic
1158684298 18:59599054-59599076 GGTTGATTAACGAAGAAGGGAGG - Intronic
925466443 2:4110784-4110806 GGGTGCTTGCCCCACAAGGAGGG - Intergenic
925881158 2:8353660-8353682 GGCTGTTTAACAACCAAGGAAGG + Intergenic
926477991 2:13352140-13352162 GGGTGATTAGACATCAAGGGTGG - Intergenic
931879702 2:66555688-66555710 GGGTGATTAACCGTTAAGCACGG + Intronic
937682071 2:124654751-124654773 GGGTGGTTAAGAAAGAAGGAAGG - Intronic
938646292 2:133333811-133333833 AAGTGATTAACACACAAGGAAGG + Intronic
948163341 2:235843098-235843120 GGGTGAAAAACCGACAAGGGTGG - Intronic
948443653 2:238015008-238015030 GGGTGATTAAGCAACCAGTTAGG + Intronic
1170057808 20:12226300-12226322 GGTACATTTACCAACAAGGATGG + Intergenic
1170358728 20:15520998-15521020 GGGTGTTTAAACCACAGGGAAGG + Intronic
1170773296 20:19352631-19352653 GGGTGAGAAACCAAGAAAGAGGG - Intronic
1172869770 20:38128879-38128901 TGGTCACTAACCAACAAGGTTGG - Exonic
1177168277 21:17627406-17627428 TTGTCATTAACCAACAAGGAAGG + Intergenic
949989684 3:9568897-9568919 GGGTGAGTAGCCAACAAGAAAGG - Intergenic
950240178 3:11362552-11362574 GGGATATTAACCAAAAATGAGGG - Intronic
952962561 3:38601870-38601892 GGGTGCCTAATCAACAAGGATGG - Intronic
956741770 3:72281059-72281081 GGGTCATGCCCCAACAAGGAAGG + Intergenic
957731362 3:84141647-84141669 GAGTGATTACCTAACAGGGATGG + Intergenic
962068524 3:132009365-132009387 GGGTGTTTAACAAGCATGGAGGG - Intronic
965924479 3:173959940-173959962 GGTTGATTAAACAAAAAAGAAGG - Intronic
966628561 3:182046647-182046669 GACTGATTAAACAACAGGGAGGG - Intergenic
966641071 3:182191335-182191357 AGGAGATAATCCAACAAGGAAGG + Intergenic
967426628 3:189334796-189334818 GAGTGACTATACAACAAGGATGG + Intergenic
970791901 4:19867933-19867955 GGGAGATAAAACAACAAAGATGG - Intergenic
972782476 4:42297978-42298000 GGGAGATTAGCCCACAAGGATGG + Intergenic
973176276 4:47209917-47209939 GAGTGATTACACAACCAGGAGGG - Intronic
979904004 4:126261316-126261338 GAGTAATTATTCAACAAGGAGGG - Intergenic
980534845 4:134104567-134104589 GGGTGTTTAACCAACCAAGTTGG - Intergenic
992232276 5:74675215-74675237 GGGTGATCAGACATCAAGGATGG + Intronic
992877852 5:81075512-81075534 GGATAAGTAAGCAACAAGGAAGG - Intronic
998091064 5:139369904-139369926 AGGTGATTAAGAAGCAAGGATGG - Intronic
1003564818 6:7214163-7214185 GGGTGATTAATCCACAGTGATGG + Intronic
1008090739 6:47291420-47291442 GGGTGAAAAACCAACATGGAAGG + Intronic
1008111164 6:47496304-47496326 GGGTGACTTAGCAACAACGATGG - Intronic
1008444170 6:51569406-51569428 AGGAGATTAAACAACAAGGAAGG - Intergenic
1009735800 6:67674732-67674754 GGGTGTTTCTCAAACAAGGAGGG + Intergenic
1010934855 6:81849318-81849340 GGGTCGTGAACCAGCAAGGAGGG + Intergenic
1011292431 6:85790680-85790702 AGGTGATTAAGCCACATGGATGG - Intergenic
1012451474 6:99356606-99356628 AGGTGATCAAACATCAAGGATGG + Intergenic
1013661894 6:112306479-112306501 GGATCAGTAAACAACAAGGATGG + Intergenic
1017102144 6:150858208-150858230 GGGAGACTAACCAGGAAGGATGG - Intergenic
1018355389 6:163009713-163009735 CGGTGATTAACCAGCTGGGATGG + Intronic
1018999416 6:168736362-168736384 AGGTGATGAACAAAAAAGGAGGG - Intergenic
1021485876 7:21168045-21168067 GGATGAGTAACCTACTAGGAGGG - Intergenic
1022086621 7:27074764-27074786 GGGTAATTAATCATCAAGAATGG - Intergenic
1029401426 7:100349262-100349284 GGATGATTATCCAAGAAGTAAGG + Intronic
1033231140 7:139598681-139598703 TGGTGAGTAAACAAAAAGGAGGG + Intronic
1033671043 7:143493393-143493415 TGGTGAGTCACCCACAAGGAAGG - Intergenic
1037591631 8:20317143-20317165 GGGTACATAAGCAACAAGGATGG - Intergenic
1039983762 8:42430198-42430220 GGCTGATTTACAAACAAGGCGGG - Exonic
1040016920 8:42707437-42707459 GGGTGCTGAACAGACAAGGAGGG + Intronic
1041746800 8:61216008-61216030 GGCAGATTAACCAACAGGCAGGG + Intronic
1046115151 8:109776062-109776084 GGTAGATTAAACAACAAAGATGG - Intergenic
1046569390 8:115943888-115943910 GGGTGATGTACCAAGGAGGAAGG + Intergenic
1048053772 8:130845082-130845104 TTGTAATTAACCAATAAGGAAGG + Intronic
1053049073 9:34943594-34943616 GGGTGATTATAAACCAAGGAAGG - Intergenic
1056796090 9:89659828-89659850 GGAAGATGAACCAAGAAGGAAGG + Intergenic
1059682316 9:116598007-116598029 TGGTTATTAACCAACAATGAAGG - Intronic
1193528133 X:82618922-82618944 GGTTGATCAAACAACAAAGATGG - Intergenic
1194127062 X:90032005-90032027 GGGAGTTCAACCAGCAAGGAGGG + Intergenic
1195169341 X:102250653-102250675 GGCTGATTACCCTACAGGGAGGG - Intergenic
1195189516 X:102436435-102436457 GGCTGATTACCCTACAGGGAGGG + Intronic
1198741980 X:139851830-139851852 GGAGGAATAACCAAGAAGGAAGG - Intronic