ID: 1124686124

View in Genome Browser
Species Human (GRCh38)
Location 15:31783475-31783497
Sequence GTGAAGAATATGAAGACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124686124 Original CRISPR GTGAAGAATATGAAGACTAC TGG (reversed) Intronic
900083755 1:876878-876900 GGGAAGGACATGAAGCCTACAGG + Intergenic
905206404 1:36345109-36345131 ATGCAAAATATGAAGACCACTGG + Intronic
906215817 1:44037919-44037941 GAGAAGAATACAAAGATTACTGG - Intergenic
909867307 1:80689325-80689347 GTGAAGAATAAGGAGAAAACAGG - Intergenic
909961401 1:81848664-81848686 GTGAAAATTATGTAGAGTACAGG + Intronic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910537431 1:88314392-88314414 GTCCAGATTATGAAGACTTCGGG - Intergenic
913135900 1:115888835-115888857 GTGTAGAATGGGAAGACTGCAGG - Intergenic
917671177 1:177275046-177275068 GTGAGGAATATGAGAACTTCTGG - Intronic
918820904 1:189253001-189253023 GTTAAGACTTTGAAGACTATTGG - Intergenic
918849588 1:189669085-189669107 ATGGAGATTATGAAGATTACGGG + Intergenic
919356757 1:196534513-196534535 ATGAAGAATAAGAAGAAAACAGG + Intronic
919438252 1:197591545-197591567 GAGAAGAATTAGAAGACTAAAGG + Intronic
920144962 1:203852159-203852181 GTGAGGAATCTGAAGAGGACTGG - Exonic
921820346 1:219609845-219609867 GTGAGGAATCTGAAGAGGACTGG + Intergenic
921863025 1:220058923-220058945 GTGAAGCATATGAACTCTGCAGG - Exonic
924005223 1:239601607-239601629 TTAAAAAATATGAAGACTAAAGG - Intronic
924081552 1:240404356-240404378 GAGATGAATAGAAAGACTACAGG + Intronic
1065389382 10:25167218-25167240 GTGAACAAAATCAACACTACTGG + Intergenic
1066596869 10:37060759-37060781 CTGAAGAATATGAGAACTAGAGG - Intergenic
1067273514 10:44813685-44813707 GGAAAGAATATGAAGACCATAGG - Intergenic
1070903334 10:80049993-80050015 GGGAAAAAAATGAAGACTAGAGG - Intergenic
1071930516 10:90464564-90464586 CTGAAGAATAGGAAGAAAACAGG - Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1073237662 10:102032037-102032059 GTTTAGAATATGAAGAATCCTGG - Intronic
1073539842 10:104309125-104309147 GTACAGAATATGGAGATTACTGG + Intergenic
1073911260 10:108347519-108347541 GTGAATAATGTGAAGAACACTGG - Intergenic
1074426021 10:113352177-113352199 ATGAAGAATATGCAGACAGCTGG - Intergenic
1074739281 10:116469251-116469273 TTCAAAAATATGAAGACTAATGG + Exonic
1076105561 10:127819997-127820019 ATGAAGAAAATGAAGCATACTGG + Intergenic
1076831740 10:132998696-132998718 GTTAAGAGGATGAAAACTACAGG - Intergenic
1080124427 11:28715646-28715668 GTGAAGAATATAATGACTACTGG + Intergenic
1080845311 11:36021617-36021639 TTGAAGAATATGCAGACTGTAGG + Intronic
1082592974 11:55037158-55037180 TGGAAGAATATGGAGACTTCTGG - Intergenic
1086333248 11:85775070-85775092 GAGATGAATAGGCAGACTACTGG + Intronic
1088059122 11:105624042-105624064 GTAAAGAATATGAAGACAATGGG + Intronic
1089674509 11:120080912-120080934 GTGAAGAAGGTGAAGCCTCCTGG + Intergenic
1092204861 12:6608505-6608527 GGGAAGAATATGAATATTATGGG - Intergenic
1093250238 12:16793871-16793893 CTGAAGAATATGGAGAATACTGG + Intergenic
1094449390 12:30568229-30568251 GTTAAGAATATGATGAAAACAGG + Intergenic
1095481211 12:42638019-42638041 GTGATGTATATGAATACTTCTGG + Intergenic
1095928215 12:47600535-47600557 TTGAAGATTTTGAAGATTACAGG - Intergenic
1098052481 12:66469194-66469216 GTGAAGAAAATGAGGTCTAAGGG - Intronic
1098410102 12:70172575-70172597 GAGAAGAATAAGAAAAGTACAGG + Intergenic
1099201895 12:79688444-79688466 GTTAAAAATATGAAGATTAAGGG - Intronic
1099829234 12:87818490-87818512 GTGAAGAATTTGAAGTCTCCAGG + Intergenic
1100739469 12:97575507-97575529 GTGATGGAGATGGAGACTACAGG + Intergenic
1105790375 13:23792376-23792398 GAGAAGACTATGAAGACTATGGG - Intronic
1106716575 13:32395261-32395283 GTTAATAATATAGAGACTACAGG + Intronic
1107334283 13:39337028-39337050 CTGGTGAATATGAAGACAACAGG - Intergenic
1107602483 13:42028086-42028108 GTGAAGAATGTGAGGGCTAGAGG - Intergenic
1108642442 13:52395371-52395393 GTAAAGAAGAGGAAGACTTCTGG + Intronic
1108895651 13:55324486-55324508 GTGAAAAATATACAGACTATTGG + Intergenic
1110297453 13:73884968-73884990 AAGAAGATTATGAAGACTGCCGG - Intronic
1110399927 13:75078129-75078151 CTGAAGAAGATGAAGATTACAGG - Intergenic
1112505528 13:99972353-99972375 GTGAAGAAGATAAAGTCTATTGG + Intergenic
1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG + Exonic
1114761586 14:25322150-25322172 GTGAAGATCAAGAAGGCTACTGG - Intergenic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1117940675 14:60960781-60960803 GTGAAAATAATGAAAACTACTGG - Intronic
1118195740 14:63624165-63624187 GTCAAGAAAATGCAAACTACAGG + Intronic
1119314135 14:73677268-73677290 GTTAAAAATATGAATACTACTGG - Intronic
1120649708 14:87117652-87117674 GGGAAGAAAATGAAAACTTCAGG + Intergenic
1123410705 15:20056533-20056555 GAGAAGAATATGGGGACTCCTGG - Intergenic
1123520034 15:21063239-21063261 GAGAAGAATATGGGGACTCCTGG - Intergenic
1124686124 15:31783475-31783497 GTGAAGAATATGAAGACTACTGG - Intronic
1124819626 15:33031565-33031587 ATGAAGCATATGATGACAACTGG - Intronic
1125741471 15:41967809-41967831 GTGAAGAATATGAAAAGTATTGG - Intronic
1126997475 15:54461869-54461891 TTGAAGAAAAAGAAGAATACTGG + Intronic
1127270965 15:57401756-57401778 GAGGAGAATATAAAGACTGCTGG - Intronic
1127320948 15:57845667-57845689 CTGAAAAATATGAAAATTACTGG - Intergenic
1131811220 15:96175500-96175522 GTGGGCAATATGAAGACTAAAGG - Intergenic
1132021705 15:98368207-98368229 TTGAGGAATATAGAGACTACAGG - Intergenic
1134534077 16:15011249-15011271 GTGAAGTATATGGACACTTCAGG + Intronic
1138724563 16:59121386-59121408 GTCAAGATTATGAGGATTACTGG - Intergenic
1139119408 16:63997592-63997614 GTGAAGAATTTCAAGCCTAAAGG + Intergenic
1142050574 16:87955429-87955451 GGGAAGCAGATGAAGACAACAGG - Intronic
1144383994 17:14731741-14731763 GTGAAAAACAGGAAGACTACTGG - Intergenic
1146801564 17:35827868-35827890 GTGAAGATTATAGGGACTACAGG + Intronic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1153570608 18:6468925-6468947 GTGAAGAATGTGTATTCTACTGG + Intergenic
1153723160 18:7928041-7928063 GAGAAGAATAAAAATACTACTGG - Intronic
1158950378 18:62488820-62488842 GTGAAGAATACCATGACTAATGG - Intergenic
1158990384 18:62862899-62862921 GAGAAGAATATAATGACAACTGG + Intronic
1159252564 18:65899042-65899064 ATTATGAATATGAAAACTACTGG + Intergenic
1159514726 18:69443841-69443863 GTGAGGACTATGATGACTACAGG - Intronic
1159660214 18:71086758-71086780 GAGAAGAACATTGAGACTACAGG - Intergenic
1159815381 18:73067448-73067470 GTGAAGAGTTTCACGACTACTGG - Intergenic
1164195811 19:22957569-22957591 ATGAAGACTGTGTAGACTACAGG - Intergenic
1164663149 19:29997059-29997081 GATAAAAATATGAAAACTACAGG - Intronic
1167224495 19:48228569-48228591 CTGAGGAATATGGAGACTTCGGG + Intronic
928467059 2:31532091-31532113 GTGATGAATAAGAGGACCACAGG + Intronic
930403801 2:50928280-50928302 GTGATGATGATGAAGACAACTGG + Intronic
930645101 2:53897797-53897819 GTGAAGAATTTAAAGACTTCAGG + Intronic
932134436 2:69215817-69215839 GTGAAGAATTTGAAGAAGAATGG - Intronic
933314261 2:80697264-80697286 GTGAAGAATATAATGACAATAGG + Intergenic
935460830 2:103331623-103331645 GAGAAGAATATGAATTCTCCTGG + Intergenic
935497375 2:103797462-103797484 GTGAAGAAAATGAAGAAGAATGG + Intergenic
936373842 2:111924481-111924503 GTGAAGAGTAGGAAGGATACAGG - Intronic
940765973 2:157789951-157789973 GAGAACAATATGAAGTCTTCAGG + Intronic
944355538 2:198783323-198783345 GTGAATCATATCCAGACTACAGG - Intergenic
945579474 2:211574829-211574851 GTTAAGAATTAGAAAACTACAGG - Intronic
947776252 2:232712489-232712511 GTGAAGAATATAGTGACTGCTGG + Intronic
1170664040 20:18370392-18370414 GGGAAGAATATGTGGATTACAGG - Intergenic
1178059098 21:28832363-28832385 GAGAAGAACAAGAAGACTCCAGG - Intergenic
1178343246 21:31803883-31803905 GAGAAGAATTTGAAGAGTCCCGG + Intergenic
1178348644 21:31853867-31853889 ATGAAGAAAATGAAGATTATGGG - Intergenic
1179396153 21:41041919-41041941 GAGAAGAAAAAGAAAACTACAGG + Intergenic
1181486242 22:23233479-23233501 CTGAAGAATGTGAAGACCCCAGG - Intronic
1182064920 22:27424015-27424037 GTGTTGAATATGATGATTACAGG - Intergenic
1183247924 22:36708250-36708272 GGGAAGAAATTGATGACTACTGG + Intergenic
1184873862 22:47260083-47260105 GTGAAGAATTTGAAGGCTGGGGG + Intergenic
951082212 3:18465897-18465919 GTGAAGAAGTTGAAGGCTACAGG - Intergenic
951619421 3:24584629-24584651 TTTAAGAATATGAAGACTGTTGG - Intergenic
955536262 3:59927103-59927125 GTGCAGTATATGAAGACAATAGG + Intronic
957037554 3:75308978-75309000 GTGAAGAAAGTGATGAGTACAGG + Intergenic
957339837 3:78881611-78881633 GAGAAGAATATGAAAAATAGTGG - Intronic
959468822 3:106723382-106723404 GGGAAGAAAATGAAGACACCAGG + Intergenic
959561005 3:107781192-107781214 GATACGAATATGGAGACTACTGG - Intronic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
960194494 3:114748662-114748684 CTGTAGAAAATGAAGATTACTGG + Intronic
961423364 3:126825934-126825956 GAGAAGAAAATGATGACAACTGG - Intronic
962002928 3:131318009-131318031 GTGAAGAATCTGAAGAAAGCAGG - Intronic
964052356 3:152411028-152411050 ATGAAGATTAGTAAGACTACAGG - Intronic
965615487 3:170587711-170587733 GTAAAGAGTATGAATACTATGGG + Intronic
967214945 3:187201831-187201853 GTTCAGAATATGCAGACTAGAGG + Intergenic
970511155 4:16783065-16783087 GTGAAGAATTTGAGGCGTACAGG + Intronic
971245985 4:24928483-24928505 ATGAAGAAAATGAAAAATACTGG - Intronic
971431599 4:26573921-26573943 GATAAAAATATGAAGACTAGGGG - Intergenic
971744431 4:30560646-30560668 GTGAAGGATAGGAAGACAATGGG + Intergenic
971841661 4:31860677-31860699 GTGAAGAATATGAGGAATTATGG - Intergenic
975358699 4:73440774-73440796 GTGAAGCATATGAAGAAGACAGG + Exonic
976383041 4:84421999-84422021 CTGAAGAGTATGAAGAGTAATGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977661184 4:99588378-99588400 GTGATGCATATCAAGTCTACAGG + Intronic
978811279 4:112852269-112852291 ATGAAGAATATGAAGAGTCAAGG - Intronic
979872873 4:125848398-125848420 GTCAGGATTATTAAGACTACTGG + Intergenic
980052129 4:128049017-128049039 ATGAAGGGTAAGAAGACTACTGG - Intergenic
981490743 4:145336818-145336840 GTCATGCAGATGAAGACTACAGG - Intergenic
981623600 4:146732286-146732308 GTAAAGAGTATGAAGACTATTGG + Intronic
982381564 4:154754509-154754531 GTAAAGAATATGAACACTTAAGG + Intergenic
983272760 4:165582436-165582458 GAGAAGAACAGGAAGAATACAGG + Intergenic
984553478 4:181186765-181186787 GGGACTAATATGAAGACTAGTGG - Intergenic
984968185 4:185159972-185159994 TTGAAGAATCTGAAGATGACAGG + Exonic
985440511 4:189980240-189980262 GGGAAGGACATGAAGCCTACAGG - Intergenic
986164643 5:5263403-5263425 ATGAAGAAAATGAAGACCAGAGG - Intronic
986473583 5:8100391-8100413 ATGAAAAATATGAGTACTACTGG + Intergenic
988371172 5:30369321-30369343 GTGAGGATTATGAAGAATATAGG - Intergenic
989411156 5:41121531-41121553 GTGACAAAAATGAAGACTTCTGG - Intergenic
989481690 5:41938083-41938105 CTGAAAAAGATGAAGACTCCTGG + Intronic
991244168 5:64491185-64491207 TTGAAGAATATGATGACTGTAGG - Intergenic
991280869 5:64911524-64911546 GTGAAGAATTTCAAGGCTAAGGG + Intronic
992706783 5:79403574-79403596 GTGAAGAAAATGAAGGAAACAGG + Intronic
993379380 5:87188865-87188887 TTGAAGAATTTGAATACTAGTGG + Intergenic
993803178 5:92370485-92370507 GTTAAAAATATGAAGATTACAGG + Intergenic
994207894 5:97056434-97056456 GTGAAGAAGATGAAGATGAAGGG - Intergenic
994968896 5:106710312-106710334 GTTTAGAATATGAATACTGCTGG - Intergenic
995976454 5:118041867-118041889 GTGAAAAAAATGAAGACTATAGG + Intergenic
997138272 5:131349724-131349746 ATAATGAATATGAAGACTAAGGG + Intronic
997148148 5:131460474-131460496 GTAAAGAATTTGAAAATTACGGG - Intronic
998544341 5:143013628-143013650 ATGGAGAATATGAAGCCTAGAGG - Intronic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
1001087472 5:168711102-168711124 GCCAAGGATATGAAGGCTACTGG - Intronic
1004103123 6:12635647-12635669 GTGAAGAACATGCTGACTATTGG - Intergenic
1005047420 6:21655229-21655251 GTGAAGAATAAGAAGAGAAAAGG + Intergenic
1006088608 6:31614823-31614845 GAGAAGAATCTGAAGTCTGCTGG - Intergenic
1007266059 6:40596836-40596858 GAGGAGAATATGAAGCCTAGGGG + Intergenic
1009565291 6:65304717-65304739 GTGAGGAATCTGAAGAGGACTGG - Intronic
1009899477 6:69794258-69794280 GTGAAGAATACAATGATTACTGG - Intronic
1012914329 6:105152510-105152532 GTGAAGAAGATATAGACTAGTGG + Intergenic
1014398298 6:120953715-120953737 GTGAAGAAATTTAAGCCTACAGG - Intergenic
1014457196 6:121649541-121649563 ATGAAGAATGAGAAGACCACAGG + Intergenic
1015181752 6:130368127-130368149 GTGAAGCTTTTGAATACTACAGG + Intronic
1015980873 6:138837270-138837292 GGGAAAAATATGAAGATTATGGG - Intronic
1017113562 6:150954930-150954952 GTGAAGAAAATAAAGAGAACTGG + Intronic
1017929913 6:158943308-158943330 CTGAAAAATTTGAAGTCTACAGG + Intergenic
1018049059 6:159991907-159991929 GTGAAGAATATGAATCCAAGTGG + Intronic
1029334793 7:99889383-99889405 GTGAAGAATAAGAAGGGTAGGGG + Intronic
1029871521 7:103697967-103697989 GTGAAGTGTATGAAGCCTGCTGG - Exonic
1031125248 7:117765974-117765996 GTGAAAAATATGAAGCATATTGG - Intronic
1031734302 7:125337923-125337945 GTGAAGAATATGTGGATTACAGG - Intergenic
1031804424 7:126291566-126291588 TTGAAGAACATGAAGATTAGAGG + Intergenic
1032573740 7:133029701-133029723 GTGAAGAAAATGCAGACTGGAGG + Intronic
1038650507 8:29398745-29398767 CTGAAAAATATAAAGACTATAGG - Intergenic
1039807155 8:41010084-41010106 GTGAAAAAGATGAAAAATACTGG + Intergenic
1040040474 8:42911655-42911677 CTGAAGAATATGAAGACAAGTGG + Intronic
1040407451 8:47119592-47119614 GTGCTGAAGTTGAAGACTACTGG + Intergenic
1042669356 8:71244713-71244735 GTGAAGAACATGTATACTTCAGG + Intronic
1043475817 8:80605274-80605296 GTGAAGAAGATGAGCACTGCAGG - Intergenic
1044158595 8:88883288-88883310 TTGAAGAAACTGAACACTACTGG + Intergenic
1045901518 8:107287002-107287024 GGGAAGAAAAAGAAGACCACTGG + Intronic
1046560513 8:115831557-115831579 TTGATGAATATAAAGGCTACAGG - Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1048462832 8:134636890-134636912 TTGAAGAAAATAAAGACTATCGG - Intronic
1049913043 9:288332-288354 GTGAAAAACATGAACGCTACAGG + Intronic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1053264472 9:36700631-36700653 GTGAAGAGTATGAAGAGAAGGGG - Intergenic
1058253074 9:102726850-102726872 GACAAGAAAATGAAGACTAAGGG + Intergenic
1058453759 9:105120382-105120404 GTGAAGAAAATGAGGTCTATAGG + Intergenic
1059617987 9:115971650-115971672 GTGGAGATTATGAGGATTACAGG + Intergenic
1059817900 9:117938518-117938540 GTGGAGAAAATGAATACTAGAGG - Intergenic
1060621736 9:125073788-125073810 GTAAATAAAATGAAGAGTACAGG + Intronic
1060893530 9:127203257-127203279 GTGGAAAATCTGAAGAATACAGG - Intronic
1188244920 X:27828373-27828395 GTGAAGAACATCAAGAGAACCGG + Intergenic
1188275938 X:28200272-28200294 GAGAACAATATAAAGATTACAGG - Intergenic
1193259324 X:79386861-79386883 GAGAAGCATATAAAGACTAGGGG - Intergenic
1195428082 X:104758044-104758066 GTAAAGAATATGAAGACCTGGGG + Intronic
1196326491 X:114411174-114411196 GTAAAGAATGTGCAGTCTACAGG + Intergenic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1201565422 Y:15360546-15360568 GGGAAGAATATATAGATTACAGG + Intergenic