ID: 1124686468

View in Genome Browser
Species Human (GRCh38)
Location 15:31786882-31786904
Sequence CTCATTATGAAATGTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 331}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124686463_1124686468 -8 Left 1124686463 15:31786867-31786889 CCCCCTTCATTCCATCTCATTAT 0: 1
1: 0
2: 3
3: 35
4: 400
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686458_1124686468 26 Left 1124686458 15:31786833-31786855 CCCCGCAGTGATATCACAGACAG 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686465_1124686468 -10 Left 1124686465 15:31786869-31786891 CCCTTCATTCCATCTCATTATGA 0: 1
1: 1
2: 2
3: 29
4: 345
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686461_1124686468 -4 Left 1124686461 15:31786863-31786885 CCGCCCCCCTTCATTCCATCTCA 0: 1
1: 0
2: 5
3: 58
4: 865
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686462_1124686468 -7 Left 1124686462 15:31786866-31786888 CCCCCCTTCATTCCATCTCATTA 0: 1
1: 1
2: 4
3: 21
4: 402
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686464_1124686468 -9 Left 1124686464 15:31786868-31786890 CCCCTTCATTCCATCTCATTATG 0: 1
1: 0
2: 2
3: 43
4: 530
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686460_1124686468 24 Left 1124686460 15:31786835-31786857 CCGCAGTGATATCACAGACAGAC 0: 1
1: 0
2: 1
3: 11
4: 194
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331
1124686459_1124686468 25 Left 1124686459 15:31786834-31786856 CCCGCAGTGATATCACAGACAGA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124686468 Original CRISPR CTCATTATGAAATGTGTGTG AGG Intronic
900492300 1:2956869-2956891 CTCAAGATGAGATGTGGGTGGGG + Intergenic
900854165 1:5167283-5167305 CTCAAGAAGAAAGGTGTGTGGGG + Intergenic
901884035 1:12210231-12210253 CTCTTTATGGAATAAGTGTGGGG - Intergenic
902722283 1:18311904-18311926 TTCAAGATGAAATCTGTGTGGGG + Intronic
903562818 1:24241331-24241353 CTCAATATGAGATTTGGGTGGGG + Intergenic
903604497 1:24565832-24565854 TTCAAGATGAAATTTGTGTGGGG - Intronic
904873290 1:33635151-33635173 CTCATTTTGGAATGAGGGTGAGG + Intronic
905007376 1:34720825-34720847 CACTTTCTGAAATGTGTCTGGGG - Intronic
905719700 1:40186672-40186694 CTCATTCTGAAAGCTCTGTGAGG + Intronic
908998235 1:70185271-70185293 TTCAAGATGAAATTTGTGTGGGG - Intronic
910276854 1:85458575-85458597 CCCATTTTAAAATGTGTGTGTGG - Intronic
910766859 1:90790783-90790805 CTCAAGATGAGATTTGTGTGGGG + Intergenic
910876631 1:91885045-91885067 CTAATGATTTAATGTGTGTGAGG - Intronic
910941220 1:92536272-92536294 CTCATTACTAAATGTTTTTGGGG - Intronic
911316713 1:96364742-96364764 CTTATTATGGAATATGAGTGGGG + Intergenic
911327265 1:96482974-96482996 CTCATCATGATATTTTTGTGAGG - Intergenic
913373044 1:118121543-118121565 CCTATTGTGAACTGTGTGTGAGG + Intronic
913581008 1:120226785-120226807 TTCAGAATGAAATGTGGGTGTGG - Intergenic
913627170 1:120671615-120671637 TTCAGAATGAAATGTGGGTGTGG + Intergenic
914562938 1:148838222-148838244 TTCAGAATGAAATGTGGGTGTGG - Intronic
914609889 1:149292000-149292022 TTCAGAATGAAATGTGGGTGTGG + Intergenic
914773018 1:150708021-150708043 CTCATTGTTAAATTTGAGTGAGG + Intronic
915884337 1:159706590-159706612 CCCATTATGAAAAGTTAGTGAGG - Intergenic
916398497 1:164418913-164418935 TTCATGATGAAATTTGTGTGGGG + Intergenic
916860690 1:168801245-168801267 TTCAATATGAGATGTGAGTGGGG + Intergenic
917114484 1:171588731-171588753 CTCATTATCAGAGCTGTGTGGGG - Intronic
919367783 1:196686189-196686211 TTCAACATGAGATGTGTGTGGGG + Intronic
919685596 1:200480499-200480521 CCCATTTTTAAATTTGTGTGTGG + Intergenic
921019001 1:211219319-211219341 CTCAATATCAAGTGTTTGTGAGG - Intergenic
921424377 1:214985028-214985050 CCCATTATGGACTCTGTGTGGGG - Intergenic
921720804 1:218469077-218469099 CTCATAAAGTCATGTGTGTGCGG + Intergenic
922078399 1:222270556-222270578 TTCAAGATGAGATGTGTGTGGGG - Intergenic
922530684 1:226342692-226342714 TTCATTATGAGATTTGGGTGGGG - Intergenic
924242299 1:242053089-242053111 GTCAATATGAGATGTGAGTGGGG - Intergenic
1062830800 10:604107-604129 CTCATCAAGGCATGTGTGTGAGG + Intronic
1063398454 10:5716533-5716555 TTCATAATGAAATGAGGGTGGGG - Intronic
1065371021 10:24986506-24986528 TTCATTATGAAATGTGAAAGAGG + Intronic
1065825985 10:29572066-29572088 CTCCTTCTAAAATGGGTGTGTGG + Intronic
1065951318 10:30654283-30654305 CTCCTTCTAAAATGGGTGTGTGG - Intergenic
1067370345 10:45676825-45676847 TTCATGATGAGATGTGGGTGGGG - Intergenic
1067746941 10:48943152-48943174 TTCATACTGAAATTTGTGTGTGG + Intronic
1069859526 10:71461740-71461762 CTCATTATAAAGTGGGGGTGAGG - Intronic
1070451403 10:76561055-76561077 CTAAGTATGGAATGTGTATGGGG + Intergenic
1071017419 10:81014254-81014276 ATCCTTATCAAATGTTTGTGAGG + Intergenic
1071039684 10:81291774-81291796 TTCATAATGAAATGTTTGTCCGG - Intergenic
1071341867 10:84656799-84656821 CTCCTTTTGAAATGACTGTGTGG - Intergenic
1071962868 10:90823695-90823717 GTCATTATGAGATTTGGGTGGGG - Intronic
1071974262 10:90939475-90939497 GTCATTATAAAATGTCTGGGAGG + Intergenic
1072403785 10:95130759-95130781 TTCAAGATGAAATTTGTGTGGGG - Intergenic
1072512864 10:96146607-96146629 TTTATTATGAAATGTGTTTATGG + Intronic
1072883859 10:99256165-99256187 CTCAACATGAGATTTGTGTGGGG + Intergenic
1073540034 10:104310657-104310679 TGCATTAACAAATGTGTGTGCGG + Exonic
1073944617 10:108735968-108735990 TTCATTATGAAATCTGTGCCAGG + Intergenic
1074312837 10:112337250-112337272 CACATTATGATATGTTTTTGTGG - Intergenic
1075920513 10:126208520-126208542 TTCATTAAGAAATCTATGTGTGG - Intronic
1079799047 11:24845568-24845590 TTCAATATGAAATTTGGGTGGGG - Intronic
1082873039 11:57961367-57961389 TTCATAATGAAGTGTGTGTTTGG + Intergenic
1085813743 11:79712936-79712958 TTCATCATGAAATGTTTGTCAGG + Intergenic
1085996063 11:81915512-81915534 TTTTTAATGAAATGTGTGTGGGG + Intergenic
1086053206 11:82618364-82618386 TTCATTATGAGATTTGGGTGGGG - Intergenic
1086564863 11:88213541-88213563 TTCAACATGAAATGTGAGTGAGG + Intergenic
1089049199 11:115531349-115531371 CTGATTAAGAAATGTGAGTCGGG - Intergenic
1090519617 11:127464446-127464468 CTAATTATTCAAAGTGTGTGAGG - Intergenic
1090703829 11:129318673-129318695 CTATTCATTAAATGTGTGTGAGG + Intergenic
1092653935 12:10665046-10665068 CTAAGTATGAAATATGGGTGAGG + Intronic
1093817436 12:23567106-23567128 ATCATGATGAAATCTGTGAGGGG + Intronic
1095365759 12:41403181-41403203 CTCAGTATTAAATGTGTGGGGGG - Intronic
1097976586 12:65692910-65692932 TTCATTATGAGATTTGGGTGGGG + Intergenic
1098124853 12:67280062-67280084 CACATTATAAAATGGGTGAGGGG + Intronic
1098856867 12:75662808-75662830 ATCAATATGAAAAGTATGTGTGG + Intergenic
1100072401 12:90736657-90736679 TTCAAGATGAGATGTGTGTGGGG - Intergenic
1100300114 12:93299131-93299153 TTTATTATGAAATGTAGGTGGGG - Intergenic
1100825033 12:98467091-98467113 CTCTTTAAGATATGTTTGTGTGG - Intergenic
1101565559 12:105901820-105901842 TTCAAGATGAAATGTGGGTGGGG - Intergenic
1101846030 12:108363807-108363829 CACAGTGTGAGATGTGTGTGTGG + Intergenic
1101979314 12:109392114-109392136 TTCATCATGAAATCTTTGTGGGG + Intronic
1105005675 12:132719185-132719207 TCCATTAGGAAATGTGTGTGTGG + Intronic
1105729372 13:23197050-23197072 CTTATTATGATCTGTGTGTATGG + Intronic
1106825483 13:33515769-33515791 CTCATTATGTATTTAGTGTGAGG - Intergenic
1107037649 13:35917879-35917901 CAAATTCTGAAATGTGTGTCAGG - Intronic
1108485066 13:50915495-50915517 ATCATGATGAAATGTGTAGGTGG - Intronic
1108909329 13:55523740-55523762 ATAATTATAAAATGTGTGTCAGG + Intergenic
1109237582 13:59843566-59843588 CTCTTTATGAAATGTCTGTGAGG - Intronic
1110511554 13:76356616-76356638 CTCAATATGAGATTTGGGTGGGG - Intergenic
1111589071 13:90320639-90320661 CTCATTAGGGAATGTTTGTCAGG - Intergenic
1112980629 13:105380482-105380504 TTCATTATGAAATTTGGGTGGGG + Intergenic
1112996045 13:105576027-105576049 CTCAAGATGAGATGTGGGTGTGG - Intergenic
1114139023 14:19890278-19890300 TTCAATATGAGATTTGTGTGGGG + Intergenic
1114590389 14:23859436-23859458 ATCATAATGAATTGTGTGTAGGG + Intergenic
1114772215 14:25440959-25440981 TTCAATATGAGATGTGGGTGGGG - Intergenic
1114928989 14:27443580-27443602 TTCAATATGAGATTTGTGTGGGG + Intergenic
1116265699 14:42687144-42687166 TTCAATATGAAATTTGGGTGGGG + Intergenic
1117236974 14:53788142-53788164 TTCATGACCAAATGTGTGTGGGG - Intergenic
1118459295 14:65974140-65974162 TTCATTATAAAAAGTGGGTGGGG - Intronic
1118514614 14:66511483-66511505 CATATTGTAAAATGTGTGTGTGG - Intronic
1119142323 14:72278557-72278579 TTCACTAGGAAGTGTGTGTGTGG + Intronic
1120358237 14:83460674-83460696 TTCAATATGAAATTTGTGTGGGG + Intergenic
1120550577 14:85867095-85867117 CTGATTATGAAATGTCTGAAAGG + Intergenic
1120576368 14:86186345-86186367 CTCATTCTGGAATTTGTATGAGG - Intergenic
1120583336 14:86280576-86280598 CTCAACATGAGATTTGTGTGGGG - Intergenic
1121481064 14:94274624-94274646 CACAATATCAAGTGTGTGTGAGG + Intronic
1123785694 15:23669968-23669990 TTCTATATTAAATGTGTGTGAGG + Intergenic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1125146591 15:36476403-36476425 CTTAATATGAGATATGTGTGAGG + Intergenic
1125274152 15:37972833-37972855 TTCATCATGAAATCTTTGTGAGG + Intergenic
1125655818 15:41355972-41355994 CTCATTAAGAAATATGTGGCCGG - Intronic
1129947583 15:79553799-79553821 ATCAATATGAAATTTGTTTGGGG - Intergenic
1130518275 15:84642924-84642946 CTCAAAAGGAAATGTTTGTGGGG + Exonic
1131715810 15:95109901-95109923 CTCAAGATGAAATTTGGGTGGGG - Intergenic
1131988618 15:98069528-98069550 CTCATTAGGAAATGCTTGAGAGG + Intergenic
1134390940 16:13819457-13819479 CTAAGTATGAAAGGTGTATGTGG - Intergenic
1135742807 16:24990956-24990978 CTCCTTCTGAAATGTGTTTATGG - Intronic
1138319157 16:56096496-56096518 ATCATTATGAAATGTTGGTCTGG - Intergenic
1138356070 16:56381308-56381330 CTCAAGAGGAAATGTGGGTGGGG + Intronic
1139789432 16:69421175-69421197 CTGATTTTAAATTGTGTGTGGGG + Intergenic
1140511861 16:75514427-75514449 TTCAATATGAGATTTGTGTGCGG - Intergenic
1141877183 16:86833861-86833883 GTCCCTGTGAAATGTGTGTGGGG + Intergenic
1144275166 17:13659677-13659699 CTGATGATGAAATGAGTGTATGG - Intergenic
1149050404 17:52297693-52297715 TTCAAGATGAAATTTGTGTGAGG - Intergenic
1149402936 17:56317455-56317477 CCCATTGTGAAATGTTTGTTTGG + Intronic
1149466712 17:56885775-56885797 CTCAAGATGAGATGTGGGTGGGG + Intergenic
1155945551 18:31846127-31846149 TTCAATATGGAATGTATGTGAGG + Intronic
1157020062 18:43770487-43770509 TGCAGTATGAAAAGTGTGTGGGG + Intergenic
1157538626 18:48482194-48482216 CCTATTGTGAACTGTGTGTGAGG - Intergenic
1158053610 18:53254112-53254134 ATGATTATTTAATGTGTGTGGGG + Intronic
1159037085 18:63287522-63287544 CTCATCATGAAATATGTTTGGGG + Intronic
1159306084 18:66643907-66643929 TTCAAGATGAAATTTGTGTGGGG + Intergenic
1159695453 18:71551921-71551943 CTCAACATGAAATTTGGGTGGGG - Intergenic
1160038936 18:75326950-75326972 ATCATTTTGAAATGCCTGTGAGG - Intergenic
1164294676 19:23899388-23899410 GTCATTTTGAAATGTCTCTGTGG + Intergenic
1168298894 19:55392089-55392111 TTCATTATGAAATATGCATGTGG + Intronic
1168421720 19:56208411-56208433 CACCTTATTAACTGTGTGTGTGG + Intronic
1168423722 19:56222342-56222364 CGCTTTATTAACTGTGTGTGTGG - Intronic
925117840 2:1395620-1395642 TTCAAGATGAAATGTGGGTGGGG - Intronic
925318355 2:2941821-2941843 CTCATTGTGAAATACGTGAGAGG - Intergenic
926679916 2:15655112-15655134 CTCATAAAGCAATGTTTGTGAGG + Intergenic
931200673 2:60094593-60094615 CTATTTATGAAATGGCTGTGAGG - Intergenic
931490720 2:62743642-62743664 CTGATTATGACACATGTGTGAGG - Intronic
932381027 2:71282850-71282872 ATCATTATGAAATGGGTCTCAGG - Intronic
932559977 2:72858925-72858947 CTTATTATTAAATTTGTTTGGGG + Intergenic
933031437 2:77333737-77333759 CTCAGTAGGAACTCTGTGTGGGG - Intronic
933131623 2:78679606-78679628 TTCAATATTAAATGTGTTTGAGG - Intergenic
933455221 2:82511377-82511399 TTCATTATGAAATATTTGTCAGG + Intergenic
934030287 2:88038901-88038923 TTCATTATGAGATTTGGGTGGGG + Intronic
934119591 2:88827054-88827076 CTCATTATAAACTGTTTCTGTGG + Intergenic
934122638 2:88855055-88855077 GTCATACTGAAATGTTTGTGAGG - Intergenic
935322069 2:101898713-101898735 CTCAAGATGAAATTTGGGTGAGG + Intergenic
936579963 2:113690889-113690911 TTCAAGATGAAATCTGTGTGGGG - Intergenic
936718706 2:115222354-115222376 TTCAAGATGAAATGTGGGTGGGG - Intronic
937266319 2:120616771-120616793 CTCCTTATAGAATGTGGGTGTGG + Intergenic
937927925 2:127182220-127182242 TTCATTATTAAATGAGAGTGTGG + Intergenic
938381417 2:130838299-130838321 CTTATTAGAAAATGTGAGTGTGG + Intronic
938511880 2:131957018-131957040 CACATTAGGTAATTTGTGTGTGG + Intergenic
939238331 2:139526230-139526252 TTCAAGATGAAATTTGTGTGGGG + Intergenic
940975992 2:159945101-159945123 CTCATTATGAATTATGTGCATGG + Intronic
941147335 2:161865606-161865628 ATAATTATGCAAAGTGTGTGAGG - Intronic
941394822 2:164961395-164961417 TTCAATATGAAATTTGGGTGGGG + Intergenic
942731717 2:179067417-179067439 TTCAATATGAGATGTGGGTGAGG - Intergenic
942926025 2:181433666-181433688 TTCAATATGAAATTTGGGTGGGG - Intergenic
942969255 2:181938028-181938050 CTCAAGAAGAAATGTGTGAGTGG + Intergenic
943622725 2:190167971-190167993 CCCAGTAGGAAATCTGTGTGAGG + Intronic
943692935 2:190887016-190887038 CTAATTATAGAATTTGTGTGAGG + Intronic
943914126 2:193606044-193606066 TTCAAGATGAAATTTGTGTGGGG + Intergenic
944263881 2:197703523-197703545 CTCATGATGAAATCTTTGTCAGG + Intronic
945646083 2:212496562-212496584 CCCATTATAATATGTGTGTTAGG - Intronic
946903832 2:224397096-224397118 TTCAATATGAAATTTGGGTGAGG - Intronic
947109409 2:226702506-226702528 CTCAGTGTTAAATGTGTTTGGGG + Intergenic
948652526 2:239457377-239457399 CCCATTATGAAATGCCTGCGTGG + Intergenic
1169322377 20:4644289-4644311 TTCAATATGAAATTTGGGTGGGG + Intergenic
1169640816 20:7749937-7749959 CTCATTAAGAAATCTGTGTTAGG - Intergenic
1169643266 20:7778954-7778976 TTCATTATGAGATTTGGGTGGGG - Intergenic
1170027390 20:11904436-11904458 TTCATCATGAAATGTGGATGGGG + Intronic
1170456531 20:16538734-16538756 TTCATCATGAGATTTGTGTGGGG - Intronic
1171103683 20:22411455-22411477 CTCATTATGAAATGCTTCTTAGG + Intergenic
1171162267 20:22938563-22938585 ATCAAAATGAAATGTGTGTGTGG + Intergenic
1177013783 21:15758926-15758948 CTCAATGTGAAATTTGGGTGGGG + Intronic
1177246523 21:18532263-18532285 CTCATGATGAAAAGTATCTGTGG - Intergenic
1177376763 21:20280340-20280362 TTCAATATGAGATGTGGGTGGGG - Intergenic
1178050099 21:28737445-28737467 CTTATTATAAAATGTTTTTGAGG + Intergenic
1178263931 21:31125012-31125034 TTCATTATAAAATGTTTTTGAGG + Intronic
1179964034 21:44790455-44790477 TTCAAGATGAAATTTGTGTGGGG - Intronic
1181345273 22:22215456-22215478 CTTATTAACAAATGTGTGTAGGG + Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183724725 22:39582138-39582160 TTCACTGTGACATGTGTGTGGGG - Intronic
949737432 3:7190015-7190037 CTTATCATGAAAGTTGTGTGTGG - Intronic
950832345 3:15887316-15887338 CTCCTTATCAAATGTTTGTTTGG - Intergenic
950892576 3:16417394-16417416 AGCATTATTTAATGTGTGTGTGG - Intronic
951222611 3:20084618-20084640 CCCATAATGAAATGTGCTTGTGG - Intronic
951483961 3:23191545-23191567 CTCAATAGGAATTGTGGGTGAGG - Intergenic
952255233 3:31689548-31689570 CTCAAGATGAAATTTGGGTGGGG - Intronic
952779996 3:37087148-37087170 AGCATTATTAAAAGTGTGTGTGG - Intronic
953727636 3:45414462-45414484 CCCATTCTGATATGCGTGTGTGG + Intronic
955884205 3:63580062-63580084 CTCAATATGAAATGGCTGCGAGG - Intronic
957341864 3:78910019-78910041 GTCTTTATGAAATGTGTCTACGG - Intronic
957485679 3:80859075-80859097 TTGATTATTAAATGTGTTTGAGG - Intergenic
957609719 3:82451434-82451456 CTCATTTTTTAATGTGTGTCAGG - Intergenic
958611777 3:96435991-96436013 TTCATGATGAAATTTGGGTGGGG + Intergenic
958690934 3:97465389-97465411 CTCCTTAAGCCATGTGTGTGAGG - Intronic
958836713 3:99155177-99155199 TTCATTATGAGATTTGGGTGGGG + Intergenic
958978621 3:100695366-100695388 CTCCTGATGAACAGTGTGTGGGG + Exonic
959383831 3:105676732-105676754 CTCAAAATGAAATTTGAGTGGGG - Intronic
960354346 3:116632615-116632637 TTCAATATGAAATTTGGGTGGGG + Intronic
961536527 3:127574021-127574043 CTCATGGTGAAATGGGTGTGTGG + Intronic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
964130944 3:153285800-153285822 CTACTTATGAAATGGTTGTGTGG + Intergenic
964519219 3:157544854-157544876 CGCATTAAGAAATGTGTGTGAGG - Intronic
964538485 3:157753038-157753060 CTCATTCTAAATTGTGTGTGTGG - Intergenic
965112840 3:164449299-164449321 TTCAACATGAAATTTGTGTGGGG - Intergenic
965761446 3:172081566-172081588 CTTATTTTGAAATGTATGTATGG - Intronic
965838841 3:172880711-172880733 CTCAGTAGGGACTGTGTGTGGGG - Intergenic
966444138 3:179981470-179981492 GTCATTATAAAATTGGTGTGGGG - Intronic
967357292 3:188586551-188586573 GTAATTATTAATTGTGTGTGAGG + Intronic
969857105 4:10008875-10008897 TTCATTATCAAATTTCTGTGCGG + Intronic
970999129 4:22302812-22302834 TTCAAGATGAAATTTGTGTGGGG - Intergenic
971753904 4:30683545-30683567 TTCAACATGAAATGTGGGTGGGG - Intergenic
971944454 4:33255608-33255630 GTCATTATGTAATGTGTATTGGG + Intergenic
971977712 4:33711453-33711475 TTCATTATGAGATTTGGGTGAGG + Intergenic
972135260 4:35885322-35885344 TTTATTATGAAATTTGGGTGGGG - Intergenic
972210081 4:36825642-36825664 TTCAACATGAAATTTGTGTGAGG + Intergenic
974573811 4:63689878-63689900 CTCAATATGAAAATTGAGTGAGG - Intergenic
975231486 4:71939418-71939440 ATTATTATCATATGTGTGTGGGG - Intergenic
975640356 4:76494058-76494080 CTAATTTTGAAATGAGTGGGTGG + Intronic
976031222 4:80756652-80756674 CTCATAAACAAATGAGTGTGTGG - Intronic
976126586 4:81839660-81839682 CTAATTATGAAATGTGTTTATGG - Intronic
977043063 4:92038175-92038197 TTCAATATGAAATTTGGGTGGGG + Intergenic
977881611 4:102211101-102211123 CTCAATATGAGATTTGGGTGGGG + Intergenic
978145207 4:105364725-105364747 ATCATTATGAGATTTGGGTGGGG - Intergenic
979441993 4:120761173-120761195 CACTATTTGAAATGTGTGTGGGG + Intronic
979632050 4:122914086-122914108 CACATTCTGGTATGTGTGTGGGG + Intronic
981436523 4:144729881-144729903 CTCATTCTGAAATTTTTGTGAGG - Intronic
982330879 4:154180951-154180973 CTCATTTTGAAATGCCTTTGTGG + Intergenic
982520892 4:156415934-156415956 TTCAATATGAAATTTGGGTGAGG + Intergenic
983643273 4:169963694-169963716 ATAAATATGAAGTGTGTGTGTGG - Intergenic
983660304 4:170125052-170125074 CTCAAGATGAGATGTGGGTGGGG - Intergenic
984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG + Intergenic
984901592 4:184591235-184591257 CTCATTTTGAACTGCCTGTGTGG + Intergenic
987191068 5:15478744-15478766 TTCAAGATGAAATGTGGGTGGGG - Intergenic
987457708 5:18166829-18166851 CTCAAGATGAAATTTGAGTGGGG + Intergenic
987681416 5:21140788-21140810 CTCATGATGAAATTTAGGTGGGG - Intergenic
988052768 5:26052284-26052306 CATATTATACAATGTGTGTGAGG + Intergenic
988316737 5:29640812-29640834 CTCATGATGAGATTTGGGTGGGG + Intergenic
988621693 5:32829889-32829911 CTCAAGATGAGATTTGTGTGGGG + Intergenic
989678680 5:44004563-44004585 CTGTTTCTCAAATGTGTGTGAGG - Intergenic
990165697 5:52990546-52990568 CTGATTTTAAAGTGTGTGTGTGG + Intronic
991096038 5:62740418-62740440 CTCATTTTGAGATGTGAGAGTGG + Intergenic
991140803 5:63240146-63240168 CTCCATATGAAATCTGTGTGTGG + Intergenic
991152179 5:63383246-63383268 CTGAAAATGAAAGGTGTGTGTGG + Intergenic
992778349 5:80107051-80107073 CTCAAGATGAAATTTGGGTGAGG - Intergenic
993585122 5:89715202-89715224 CTCAATACAAAATGTCTGTGTGG - Intergenic
993717047 5:91285416-91285438 TTCATGATGAAATTTGGGTGGGG + Intergenic
994465579 5:100125358-100125380 CACATTAGGACATGTGTGAGAGG - Intergenic
996292776 5:121873450-121873472 GTCATTAGGAAATATGTGTAAGG + Intergenic
996623536 5:125540704-125540726 CTAATTTTCAAATTTGTGTGTGG + Intergenic
997742212 5:136266219-136266241 CTCATTATGAAGTGGGTCTTAGG - Exonic
998298991 5:141000204-141000226 TTCATTATCAAATGCCTGTGTGG + Intronic
999006937 5:147991904-147991926 CTCATTCTAATATGTTTGTGTGG + Intergenic
999953002 5:156670389-156670411 TTTATTATGGAAAGTGTGTGGGG + Intronic
1000761738 5:165233998-165234020 TTCAATATGAAATTTGAGTGGGG + Intergenic
1002392983 5:178930188-178930210 TTCAATATGAAATTTGGGTGGGG + Intronic
1003360796 6:5423311-5423333 CTCATTCTGAAATCTGGGTATGG - Intronic
1003435436 6:6083830-6083852 CTCACTTTTAAATGTGTGTTTGG - Intergenic
1003738986 6:8913122-8913144 TTCATTATGAAATGTTTGCCAGG - Intergenic
1004001464 6:11600724-11600746 CCCATGTTGAAATGTGTCTGTGG + Intergenic
1004191442 6:13467441-13467463 CTCTTTATGGGCTGTGTGTGTGG - Intronic
1004420324 6:15463805-15463827 CTCAGTATGAAATGGGTGAATGG - Intronic
1004473055 6:15946300-15946322 CTCATCATGAAACGTTAGTGAGG + Intergenic
1008751566 6:54739903-54739925 TTCAATATGAAATTTGGGTGAGG - Intergenic
1009621261 6:66080811-66080833 TTCATTATGAAATCTTTGTCAGG + Intergenic
1009963025 6:70546995-70547017 CTCATTATGGAATGTCAGAGTGG - Intronic
1010104914 6:72155811-72155833 CTCAAGATGAGATGTGGGTGGGG + Intronic
1010287185 6:74092708-74092730 CTCAATATGCAATGTGTTTTTGG + Intergenic
1010437935 6:75857375-75857397 CATATTATGAAATGTGAGTGTGG - Intronic
1010884394 6:81218291-81218313 CTCAGTAGGGACTGTGTGTGGGG - Intergenic
1010890931 6:81309565-81309587 CTCATTATGAGATCTGTAAGGGG + Intergenic
1013091228 6:106902497-106902519 TTCAATATGAAATTTGGGTGGGG - Intergenic
1013687933 6:112608123-112608145 CTCAAGATGAAATTTGGGTGGGG - Intergenic
1013731262 6:113170424-113170446 CTCATCTTGAAATGTAGGTGGGG + Intergenic
1013810703 6:114041468-114041490 CTCATAAAGAAATGTGTGCCAGG - Intergenic
1014060453 6:117065356-117065378 TTTATTTTGAAATGTGTGGGGGG - Intergenic
1015234959 6:130960170-130960192 TGCATTATGAAGTGTGTGTGAGG - Intronic
1015740840 6:136451894-136451916 CTCATGATAAAATGTGAATGGGG + Intronic
1016020410 6:139231147-139231169 GGTTTTATGAAATGTGTGTGTGG - Intergenic
1016134275 6:140519899-140519921 CTCAAGATGAGATTTGTGTGGGG - Intergenic
1016910655 6:149195304-149195326 CTCAAAATGAAATGTGCTTGGGG - Intergenic
1017911097 6:158793718-158793740 AGCATTTGGAAATGTGTGTGTGG - Intronic
1018506908 6:164481750-164481772 CTCATTTGGAAATGGGGGTGGGG - Intergenic
1021008626 7:15433899-15433921 CATTTTATGTAATGTGTGTGTGG + Intronic
1021032948 7:15761424-15761446 CTCATGTTGAAATGTGAATGTGG - Intergenic
1021753868 7:23832570-23832592 TTCAAAATGAAATGTGAGTGGGG - Intergenic
1024827176 7:53404314-53404336 TTTACTATGAAATGTGAGTGAGG - Intergenic
1025965162 7:66262768-66262790 CTGATAAGGAAATGTGTGTTGGG + Intronic
1026434999 7:70388701-70388723 CTCATTATGAAATGGATATTAGG - Intronic
1026730224 7:72905021-72905043 TTCAGGATGAGATGTGTGTGGGG + Intronic
1027400738 7:77803513-77803535 CTCATTATGTAATATTTTTGAGG + Intronic
1027601144 7:80242842-80242864 CTCATTATAAAATATTTGAGTGG - Intergenic
1028083895 7:86613787-86613809 TTCATTATGAGATTTGAGTGGGG - Intergenic
1028346235 7:89787226-89787248 GTCATTATGAAATGTGTTAAAGG - Intergenic
1029412696 7:100426039-100426061 CACATTCTGAATGGTGTGTGGGG - Intronic
1031207800 7:118783226-118783248 CTAATTGTGAAAAATGTGTGTGG - Intergenic
1031575916 7:123415750-123415772 TTCATTTTGATATGTGTGTTTGG - Intergenic
1033382323 7:140834289-140834311 TTCATTATCTAATGTGTGTCAGG - Intronic
1033758247 7:144414752-144414774 CTAATTACTACATGTGTGTGAGG - Intergenic
1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG + Intronic
1035173610 7:157034517-157034539 CTCATTTAGAAATATTTGTGGGG - Intergenic
1037036003 8:14168366-14168388 TTCAATATGAAATTTGGGTGGGG - Intronic
1037100414 8:15037136-15037158 TTCATGATGAGATTTGTGTGGGG - Intronic
1037132023 8:15418172-15418194 TTCATCATTAAATGTGTTTGGGG + Intronic
1037630863 8:20654354-20654376 GCTATTATGAAATGCGTGTGAGG - Intergenic
1038697702 8:29820701-29820723 CTGTGTATGAAGTGTGTGTGTGG - Intergenic
1040297158 8:46159036-46159058 CTTTTTATGTAATGTGTGAGTGG - Intergenic
1040686024 8:49874537-49874559 CTCATCCTCAAATGTGTGTCTGG - Intergenic
1040948157 8:52906828-52906850 CTCATTATCAATTGAGTGTGGGG + Intergenic
1041544356 8:59025259-59025281 TTCATTATAATATGTCTGTGTGG + Intronic
1042052842 8:64730818-64730840 TTCATGATGAAATTTGGGTGGGG - Intronic
1043145512 8:76648705-76648727 CTCAATATGAGATTTGGGTGGGG - Intergenic
1043335276 8:79168561-79168583 CTTCTTATGAAATGTATGTGAGG - Intergenic
1043714740 8:83467583-83467605 CTCAATATGAGATTTGGGTGGGG - Intergenic
1044751917 8:95424228-95424250 CTCATTAGAAAATATGTGTGAGG + Intergenic
1044795864 8:95897015-95897037 CTCATTATGAAATAACTGGGAGG - Intergenic
1044973308 8:97640902-97640924 CTCATTAAAAAATGTTTTTGTGG + Intergenic
1045138274 8:99248212-99248234 ATAGTTATGAAATTTGTGTGTGG + Intronic
1046295575 8:112215427-112215449 TTCAACATGAAATTTGTGTGGGG - Intergenic
1047882280 8:129208875-129208897 CTGATTTTGACATGTTTGTGGGG - Intergenic
1048107669 8:131428729-131428751 CTCAAGATGAAATTTGGGTGGGG + Intergenic
1048622834 8:136153556-136153578 CTCAAGATGAAATTTGGGTGGGG - Intergenic
1050691012 9:8225831-8225853 CTCATTATGATATATATGTGGGG + Intergenic
1051707920 9:19899952-19899974 TTCAAGATGAGATGTGTGTGGGG + Intergenic
1051718734 9:20012448-20012470 TTCAAAATGAAATGTGGGTGGGG + Intergenic
1053395290 9:37768179-37768201 CCCTTTATGAAGAGTGTGTGAGG + Exonic
1053852373 9:42301846-42301868 TTCAAGATGAAATTTGTGTGGGG - Intergenic
1055886056 9:81064085-81064107 TTCATTATGAGATTTGGGTGGGG - Intergenic
1056590135 9:87960257-87960279 CTAATTATGCAATGTATGTTAGG - Intergenic
1057221426 9:93259730-93259752 CTCAGGAAGAGATGTGTGTGAGG + Intronic
1057379813 9:94557554-94557576 CTCAAGTTGAAATGTGTCTGTGG + Intergenic
1057633692 9:96742599-96742621 TTCAAGATGAAATGTGGGTGCGG - Intergenic
1058459848 9:105172659-105172681 CTTACTATGAACTGTGTGCGTGG - Intergenic
1060235534 9:121860046-121860068 CTGCTCAGGAAATGTGTGTGAGG + Intronic
1060243321 9:121923869-121923891 CTCAAGATGAAATTTGGGTGGGG - Intronic
1060516794 9:124270964-124270986 CTCTGTGTGAAATGTGTGTGTGG - Intronic
1062641897 9:137523069-137523091 CTGACGATGAAATGTGGGTGAGG + Intronic
1186836854 X:13446928-13446950 CACATGATGAAATCTGTGAGTGG - Intergenic
1187054388 X:15728408-15728430 TTCATCATGAAATCTCTGTGAGG + Intronic
1187639542 X:21273402-21273424 TTCAATATGAAATTTGGGTGGGG + Intergenic
1187654674 X:21457781-21457803 CTGCTTTTGAAATTTGTGTGTGG + Intronic
1189075418 X:37909116-37909138 ACCATTTTGAACTGTGTGTGGGG - Intronic
1193208165 X:78773453-78773475 CTCAGTAAGAAATGTTTCTGTGG + Intergenic
1193291066 X:79773125-79773147 TTCAATATGAAATTTGGGTGGGG + Intergenic
1193572916 X:83166210-83166232 TTCAATATGAGATTTGTGTGGGG - Intergenic
1194923100 X:99792132-99792154 TTCAAGATGAAATGTGGGTGGGG + Intergenic
1196687372 X:118523181-118523203 CTCATAATGAAATGGCTTTGAGG + Intronic
1197041447 X:121940554-121940576 TTCATTTTGAATTATGTGTGTGG + Intergenic
1198457790 X:136834307-136834329 TGCATTATGAAAAGTTTGTGGGG - Intergenic
1198693002 X:139304575-139304597 CTTCTTTTGAAATATGTGTGTGG - Intergenic
1198872651 X:141192697-141192719 CTCAAGATGAAATTTGGGTGGGG - Intergenic
1198996212 X:142577198-142577220 TTCATGATGAAATTTGGGTGGGG - Intergenic
1199277947 X:145968789-145968811 TTCAAGATGAAATTTGTGTGGGG - Intergenic
1200377385 X:155797499-155797521 TTCAATATGAGATGTGGGTGGGG + Intergenic