ID: 1124687410

View in Genome Browser
Species Human (GRCh38)
Location 15:31794023-31794045
Sequence AAGAAGGCTTAGATGTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124687410 Original CRISPR AAGAAGGCTTAGATGTAGAA GGG (reversed) Intronic
901268492 1:7931642-7931664 AAGAGGGCTGTGATCTAGAAAGG + Intronic
902177086 1:14658549-14658571 CAAAAGACTTTGATGTAGAAAGG - Intronic
902318248 1:15640349-15640371 AAGAAAACTTAGATATAGAGAGG + Intronic
903017816 1:20373111-20373133 AAGAGGGCATAGCTGTAGGAAGG + Intergenic
906270344 1:44472892-44472914 AAGAAGGATCAGAGGGAGAAAGG - Intronic
911980872 1:104564049-104564071 AAGAAAGCATAGAGTTAGAAAGG - Intergenic
914091004 1:144498530-144498552 AAGAATGCTGACATGTAGAGGGG - Intergenic
914931581 1:151939004-151939026 AAGAGTCCTTAGAAGTAGAAAGG - Intergenic
916317529 1:163466687-163466709 AAAAAGGATTATATGTAAAAAGG + Intergenic
917154230 1:171978760-171978782 GAGCAGGCTTAGAAGTAGCATGG + Intronic
917318038 1:173748984-173749006 AGGAAGGATTAGAACTAGAAGGG - Intronic
917855573 1:179096580-179096602 AGGAAGGCTTAAATTAAGAAAGG - Intronic
917981276 1:180271280-180271302 AGGCAGGCTTAGGTGCAGAAAGG + Intronic
918125005 1:181575534-181575556 AAGAAGGCTCAAATGTAGAGGGG - Intronic
918987351 1:191650229-191650251 GAGAGGTCTTAGATTTAGAATGG - Intergenic
919649838 1:200136730-200136752 TAGAAGGATCAGATTTAGAATGG - Intronic
920544582 1:206804939-206804961 AAGAAGGGTATGATTTAGAAAGG - Intronic
920796068 1:209137917-209137939 AAGAAATCTGAGATGTAAAAAGG + Intergenic
922330221 1:224568327-224568349 AACAAGACTTAGAAGAAGAATGG + Intronic
923860336 1:237886500-237886522 ATGTAGGCTGAAATGTAGAATGG + Intronic
924788771 1:247223740-247223762 AAGAAGCATTAAATGTGGAAAGG + Intergenic
1063225276 10:4009668-4009690 AGGAAGGGTTTAATGTAGAATGG + Intergenic
1064449706 10:15430658-15430680 AATAAGACTTAGAAGTGGAATGG + Intergenic
1064594715 10:16932006-16932028 AGGAAGGCTTAGATGTGAAGAGG + Intronic
1065207987 10:23375199-23375221 AAGATGGCTTAGTTTTGGAAAGG + Intergenic
1065414424 10:25469075-25469097 AAGCAGGCTGAGATGGAGCAGGG - Intronic
1066353011 10:34654782-34654804 AGGAAAGCATAGATGTGGAAAGG - Intronic
1067746681 10:48941463-48941485 AAGAAGGCCGAGATGTGGCAGGG + Intronic
1068130811 10:52893085-52893107 AAGAGGACTTAGCTCTAGAAAGG - Intergenic
1069377014 10:67803212-67803234 AAGAAGACATAGATGCAGAGGGG + Intronic
1070114667 10:73516912-73516934 AAGGAGGCTTAGAATCAGAAGGG + Exonic
1070643828 10:78187669-78187691 TAAAAGGCTTAGATGAGGAAGGG - Intergenic
1073374954 10:103025398-103025420 AAGAAAGCTTATCTCTAGAATGG - Intronic
1073517593 10:104091175-104091197 AGGAAGGCTTAGGTGGAGAGTGG + Intergenic
1074952483 10:118352014-118352036 TGGATGGCTTAGATGCAGAATGG - Intergenic
1075141956 10:119845865-119845887 AAGAAGTCATAAATATAGAAAGG + Intronic
1075638296 10:124045543-124045565 AAAATGTCTTAGATGTAGCAAGG - Intronic
1075995779 10:126875045-126875067 TAGAAGGATTAGAAGTAGCAGGG - Intergenic
1076164463 10:128270397-128270419 AAGAAGGCATAGCCGTGGAAAGG + Intergenic
1076192042 10:128489836-128489858 AAAACAGCTTAGAAGTAGAATGG + Intergenic
1077631950 11:3816991-3817013 GAGAAGGGTCAGAGGTAGAAAGG - Intronic
1077928161 11:6703318-6703340 AAGAAGGCTTAATTTTACAAAGG + Intergenic
1078612306 11:12831214-12831236 AAGAAGGGTAAGATTTAGACAGG - Intronic
1081167985 11:39830105-39830127 AAGAAGGATACGATGGAGAAAGG + Intergenic
1082647446 11:55745891-55745913 GAGAAAACTGAGATGTAGAAAGG - Intergenic
1085374041 11:76041481-76041503 AAGAAGAGCTAGATGCAGAATGG + Intronic
1085938021 11:81173260-81173282 AAGAAGGGAGACATGTAGAAAGG + Intergenic
1087140921 11:94765239-94765261 AAGAAGGCACAGATGTGGACTGG + Intronic
1087639425 11:100740621-100740643 AAGCAGAGTTTGATGTAGAATGG + Intronic
1088085294 11:105970844-105970866 ATGAAGGCTAAGATGATGAATGG - Intronic
1089665463 11:120015128-120015150 TAGAAGGATTAAATGTAGTAGGG - Intergenic
1092910294 12:13140109-13140131 ATGAGGGATTAGATGTAGGATGG - Intronic
1092910402 12:13140544-13140566 ATGAAGGATTGGATGTAGGATGG - Intronic
1094101872 12:26773223-26773245 AAGTAGGCTAACATGGAGAAAGG + Intronic
1096937325 12:55296045-55296067 TAGAATTCTTATATGTAGAAAGG - Intergenic
1101488463 12:105190281-105190303 AAGAAGGTTTATTTGTAGAATGG - Intronic
1101554602 12:105797038-105797060 AAGAAGGGATAGATGAACAAAGG + Intergenic
1102310362 12:111840291-111840313 CTGAAGGATTAGATGTGGAAGGG - Intergenic
1103136169 12:118509768-118509790 AAGAAGGCTTAAATGCATCAAGG - Intergenic
1103158071 12:118704541-118704563 AAGAGGGTTTATATGTACAAGGG + Intergenic
1104635097 12:130433537-130433559 AGGAAGGCTCAGAGGTAGAAAGG - Intronic
1107186963 13:37534467-37534489 AGGAAGGCTTAGATATGGAAGGG + Intergenic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108619060 13:52163300-52163322 AAGAAGACTTAGTTACAGAAGGG - Intergenic
1109018321 13:57049931-57049953 AAGGAGCATTAAATGTAGAAAGG + Intergenic
1111605014 13:90526615-90526637 AACAAGGCTTATATGGAGTAGGG - Intergenic
1112164544 13:96904208-96904230 AAGAAGAGCTGGATGTAGAATGG + Intergenic
1114910292 14:27185406-27185428 AAGAAGTAATAGATGTAAAATGG - Intergenic
1115461943 14:33671078-33671100 GAGAATGCTTAGATAAAGAAAGG - Intronic
1116287866 14:42995779-42995801 AATAAGGCTTCGAAGTAAAAGGG + Intergenic
1117949610 14:61068977-61068999 ATGAAGGCTGAGATTTAGATAGG - Intronic
1120109513 14:80537363-80537385 AAGAATGATTTGATGGAGAAGGG + Intronic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1121425840 14:93851336-93851358 ACAAAGGCTTAGAGGTTGAATGG + Intergenic
1121515387 14:94546249-94546271 TAGAAGGCTGAGATCTGGAAAGG - Intergenic
1124687410 15:31794023-31794045 AAGAAGGCTTAGATGTAGAAGGG - Intronic
1125801163 15:42448645-42448667 AAGAAGCCTTAGATTTGGATGGG - Exonic
1127651797 15:61016160-61016182 GAGAAGACTGAGATGTAGAGAGG - Intronic
1127925561 15:63537345-63537367 AAGGAGGCCTAGAAGTTGAAAGG - Intronic
1128803815 15:70515599-70515621 GAGAATGCTTTGATGCAGAAAGG - Intergenic
1130128709 15:81117789-81117811 ATGAAGACGAAGATGTAGAAGGG - Intronic
1130266646 15:82411022-82411044 TAGAAGGCTGAGATGTTAAATGG + Intergenic
1130505380 15:84535864-84535886 TAGAAGGCTGAGATGTCAAATGG - Intergenic
1131664722 15:94558043-94558065 GAGAAGACTTAGATTTAGAGAGG + Intergenic
1135299883 16:21317000-21317022 AAGGAAGCTGTGATGTAGAAAGG - Intergenic
1135869107 16:26132695-26132717 AAGAAGGCAAAGGTGAAGAATGG + Intronic
1137579620 16:49625988-49626010 AAGAAGGCTCAGATGGAGAAAGG + Intronic
1137814425 16:51384956-51384978 GAGAAGACTGAGATGCAGAAGGG + Intergenic
1138258799 16:55597720-55597742 ACGAGGGCCTATATGTAGAATGG - Intergenic
1138389493 16:56659714-56659736 ACCAAGGTTTAGATGTGGAATGG - Intronic
1138398829 16:56729680-56729702 GAGAATGCTTGGATGTTGAAGGG - Intronic
1146552017 17:33788852-33788874 GAGAACGCATAGATGTAGAGAGG + Intronic
1149639097 17:58191691-58191713 AGGAAGGCTTAGGTGCAGAGAGG + Intergenic
1149751620 17:59151428-59151450 AAACATGCATAGATGTAGAAAGG + Intronic
1152836267 17:82534259-82534281 AAGATGGCTGATATGTAGAGGGG + Intronic
1156250441 18:35347036-35347058 AACAAGGCTTAGCTGCAGCATGG + Intergenic
1156808706 18:41221331-41221353 AAGGAAGCTTAGATTTAGAGAGG - Intergenic
1158029700 18:52948548-52948570 TAGAAGACTTAGATTGAGAAAGG + Intronic
1158452602 18:57580624-57580646 AAGAAGGCTTGGAGGCAGAAAGG - Intronic
1158569371 18:58583927-58583949 AAGAAGGCTGAGAGGCACAAGGG + Intronic
1158688462 18:59637526-59637548 AAGAAAGCTAAGGTGTACAAAGG + Intronic
1160125369 18:76166859-76166881 AAGGAGGCTCAGATGAAGAGGGG - Intergenic
1161934669 19:7364326-7364348 AAGAAGGATGAGAGGAAGAAAGG + Intronic
1161944201 19:7424697-7424719 AAGAAGGCTCAAATTTAGACTGG + Intronic
1163967244 19:20757820-20757842 AAGAGGGCTTAGATGAAAATAGG - Intronic
1165799048 19:38536474-38536496 ATGAAGACATAGAGGTAGAAAGG - Intronic
925229769 2:2222650-2222672 AAGAGGGCTAAGATGTAAGATGG + Intronic
925480189 2:4261879-4261901 AAGAAGGGAAAGAGGTAGAAAGG + Intergenic
925618706 2:5769140-5769162 GAGAAGCCCTGGATGTAGAAGGG + Intergenic
925908088 2:8551504-8551526 ATGAAGGCTTAGAAGTGGGAAGG - Intergenic
927599657 2:24429955-24429977 ATGACTGCTTAGATGTGGAAGGG - Intergenic
927763704 2:25784291-25784313 AAGGAGGCTTACATATACAAGGG - Intronic
928850230 2:35736150-35736172 AAGAAGCACTAAATGTAGAAAGG + Intergenic
929540290 2:42814070-42814092 TAGAATGCTTGGATGAAGAAGGG + Intergenic
931866147 2:66413811-66413833 AACAAGGCTTAGATCTAGGCTGG - Intergenic
933485347 2:82915168-82915190 AAGAAGACTTAGAAGAAGCAGGG - Intergenic
934904329 2:98185787-98185809 CAGGAGGCTGTGATGTAGAAAGG - Intronic
934931580 2:98430004-98430026 AAAAAGGCTTAGAAGTGAAAGGG - Intergenic
936239422 2:110774048-110774070 ATGAAGGCTTAGATTGAAAAGGG - Intronic
936927727 2:117754878-117754900 AAGAAGGTTTAGAAGGAGGAAGG - Intergenic
937512335 2:122610079-122610101 AAGGAGGCTTAGTTCTTGAAAGG + Intergenic
937773537 2:125749388-125749410 AAAATGGATTAGATCTAGAAAGG + Intergenic
939198279 2:139001101-139001123 AAGAAGACTTTGGTGTCGAAAGG + Intergenic
942784053 2:179679551-179679573 AAGAAGGCTTAGAATTTTAATGG - Intronic
943459999 2:188160821-188160843 CAGAAGCCTTAGAATTAGAAAGG + Intergenic
945016110 2:205518725-205518747 AAGAAGCTTTAAATATAGAAAGG - Intronic
945622729 2:212161551-212161573 ATGAAGCCTTTGAGGTAGAAAGG - Intronic
948297639 2:236874818-236874840 AAGCATGCTTAGATGGAGACAGG + Intergenic
1170805535 20:19627456-19627478 AAGTAGACTTCCATGTAGAATGG - Intronic
1171124540 20:22590235-22590257 AAGAAGGCTTAAAAGTAAAGAGG - Intergenic
1171804560 20:29663025-29663047 ATGAAGGCTTTGATTAAGAAAGG - Intergenic
1173094838 20:40015520-40015542 AAGGAAGCTGAGATGTAGAGGGG - Intergenic
1173291416 20:41718212-41718234 AAGAAGGATTAGATGCTGAGTGG - Intergenic
1173798520 20:45879653-45879675 TTGAAGGCTTAGTTGTAGGAAGG - Intergenic
1175518745 20:59586105-59586127 AGGGAGGCTTGGATGGAGAAGGG - Intronic
1177348650 21:19905336-19905358 AAGAAGAGTTAGATGGATAATGG + Intergenic
1177776603 21:25574794-25574816 AAACAGGCTTAGAAGTGGAAAGG - Intergenic
1177866340 21:26517480-26517502 AAGAAGACTCAGATGGGGAATGG + Intronic
1179393400 21:41014672-41014694 AAGAAGATTCAAATGTAGAATGG + Intergenic
1179585570 21:42372015-42372037 AATAAGTCTTGGAAGTAGAAAGG + Exonic
1182642977 22:31783245-31783267 AACAAGGCTTCCATGTGGAAGGG - Intronic
1182939898 22:34265765-34265787 AAAAAGGCTAACATGTATAAGGG + Intergenic
1184263658 22:43334239-43334261 AAGTAGGCTTAGTTGAACAAAGG + Intronic
949250393 3:1976655-1976677 AGGAAGTCTTAAATATAGAAAGG + Intergenic
951317038 3:21200512-21200534 AAGAAGGATTGGATTTAAAATGG - Intergenic
951462776 3:22969131-22969153 AAGAAGCCTGAGCTGTAGGATGG + Intergenic
954221049 3:49154183-49154205 TAGAAGGCATAGTAGTAGAAGGG + Intergenic
956219127 3:66883613-66883635 AAGAAGTATTAGAAGTACAAGGG + Intergenic
956978632 3:74611832-74611854 AAGAAGGCTTAAAGGCAGACTGG + Intergenic
957219672 3:77365638-77365660 CAGAAGACTTAGGTGTAGAAAGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958056234 3:88415964-88415986 TAGAAGGCTTAAATGAAAAAGGG + Intergenic
958536229 3:95408149-95408171 AAAAAGGCTTAGAAGCAAAAGGG - Intergenic
958645134 3:96860597-96860619 AAGAAAGGTTAGAACTAGAAAGG + Intronic
959224786 3:103565835-103565857 AAGGAGACTAAGATGGAGAATGG + Intergenic
960545472 3:118909581-118909603 ATTAAGGCATAGATGGAGAAGGG + Intronic
961140881 3:124554987-124555009 GTGAAGGCTTAAATGTAGAATGG - Intronic
961793237 3:129391612-129391634 AAGAAGGGTTAGAGGTTGAGAGG - Intergenic
962039828 3:131695091-131695113 AAGAGGGCAAAGTTGTAGAATGG - Intronic
963710580 3:148742702-148742724 AAGATGGCTTATTTGTATAATGG + Exonic
965511725 3:169575303-169575325 CAGATGGCTTAGATTGAGAAAGG - Intronic
967859865 3:194142256-194142278 AGGAAGGGTTAGAAGCAGAAGGG + Intergenic
970493595 4:16602429-16602451 AAGAAGGCTTTGTGGTAGGAGGG + Intronic
970633914 4:17985906-17985928 AAGGAGCATTAAATGTAGAAAGG - Intronic
972822827 4:42721859-42721881 AAGTTGACTTAGATATAGAACGG + Intergenic
973745181 4:53957030-53957052 AGAAAGACTTAGATTTAGAAAGG + Intronic
974222158 4:58989014-58989036 AACAAGGATTAAATGTGGAAAGG + Intergenic
974334824 4:60528574-60528596 AAAAAGGCTCAGATGCACAAAGG + Intergenic
974678736 4:65133261-65133283 AACAAGGCTCAGAAGAAGAAAGG + Intergenic
976249997 4:83040612-83040634 AAGATGGCTGAGAGGTAGAGTGG - Intronic
976488996 4:85644432-85644454 AAGAGGTCTTAGATGTAATATGG - Intronic
976847941 4:89511559-89511581 AAGAAGACTGAGACTTAGAAAGG - Intergenic
978487720 4:109275188-109275210 AAGAAGGCGTGCATGTAGCATGG + Intronic
980527289 4:134007547-134007569 GAGAAGGCTTATATGTAATAAGG + Intergenic
980879732 4:138697625-138697647 AAGAAGAGAGAGATGTAGAAAGG - Intergenic
981076541 4:140598211-140598233 TAGAAGGTTTAGAAGGAGAAGGG + Intergenic
982241729 4:153306577-153306599 AAGAAGGAATAGATGGGGAATGG + Intronic
982656730 4:158159289-158159311 AAGAAGGCCTGTATGTGGAAAGG - Intronic
983723303 4:170886427-170886449 GAGAGGAATTAGATGTAGAAAGG + Intergenic
986938716 5:12922397-12922419 AAGAAGGTTTAGAGGGAGCATGG - Intergenic
987626027 5:20401950-20401972 AAGAAGGCTTAGAAGATCAAAGG - Intronic
989029915 5:37108281-37108303 AACAATGCTTACTTGTAGAAGGG + Exonic
990120017 5:52439807-52439829 CAGATGGCTTAGATTTATAATGG - Intergenic
991547583 5:67800489-67800511 AAGAAGGCTTACACGTGGAGAGG + Intergenic
992611776 5:78514189-78514211 AAGAAGTCTTTTAGGTAGAATGG - Intronic
993610496 5:90047541-90047563 AAGAGAGCCTAGATGTACAAGGG + Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
998892114 5:146757254-146757276 CAGAAGGTTTAGAAGTAGAGCGG + Intronic
1000958582 5:167571990-167572012 GAGAGTGCTCAGATGTAGAAGGG - Intronic
1002479851 5:179492909-179492931 CACAAGGCTTATATGCAGAAAGG + Intergenic
1002945424 6:1756755-1756777 CAGAACGCTTAGCTGGAGAATGG - Intronic
1007090809 6:39183804-39183826 GAGAAAGCTTGGAGGTAGAAAGG - Intergenic
1007861672 6:44916379-44916401 AATAAGGCTTAGAGGCAGTAAGG - Intronic
1010449448 6:75986482-75986504 CTGAAGGCTCAGATCTAGAAGGG + Intronic
1010568481 6:77448367-77448389 AAGAAGGCCTAGCTGGAGATAGG + Intergenic
1011059611 6:83249626-83249648 AAGAAAGTTTAAATGTAAAATGG - Intronic
1011208707 6:84930832-84930854 AAGAAGTCTTAGAAGCAGAGAGG - Intergenic
1011864429 6:91805751-91805773 CAGAAAGCTTAAATGTTGAAGGG + Intergenic
1012180083 6:96141943-96141965 CAGAAGGCTGGGATGTAAAATGG - Intronic
1012955420 6:105564711-105564733 ACAAAGGCTTAGTTGCAGAAGGG + Intergenic
1014747189 6:125214029-125214051 ACGATGGCTGAGCTGTAGAAGGG + Intronic
1014948124 6:127519865-127519887 AGGAATTCTTAGAGGTAGAAGGG - Intronic
1017196434 6:151705466-151705488 AAGATGACTCAGATGTACAAAGG + Intronic
1018266658 6:162031392-162031414 AAAAAGGATTAGATGTTGAGAGG - Intronic
1018961784 6:168454665-168454687 GAGGAGGCTTTGATGAAGAAAGG + Intronic
1019799890 7:3080493-3080515 TAGAAGGCCTGGATTTAGAAAGG + Intergenic
1020480202 7:8649933-8649955 AAGAAGGCTTAAATTAAGGAGGG + Intronic
1021402600 7:20226611-20226633 AAGAAGGCTTTTCTGTGGAACGG - Intergenic
1021562503 7:21982434-21982456 AAGGAGAATGAGATGTAGAAGGG + Intergenic
1021991284 7:26143787-26143809 AAGAATGCTTGGTTGAAGAAGGG + Intergenic
1025242113 7:57285711-57285733 TAGGAGGCTAAGCTGTAGAAAGG + Intergenic
1027526304 7:79273495-79273517 AAGAAGGCTTAAAAATTGAATGG + Intronic
1027669891 7:81083295-81083317 AAAAAGTTTTAGATTTAGAAAGG - Intergenic
1028247243 7:88494966-88494988 AAGAAAACTGAGATGTAGAGAGG - Intergenic
1028726891 7:94097945-94097967 AAAAAGGCATATATGTAGAAAGG + Intergenic
1030505267 7:110414031-110414053 AAAAAGGTTTGGATGGAGAAAGG - Intergenic
1032250927 7:130256664-130256686 AAAAAGGCTTAGAAGCAAAAGGG - Intergenic
1032504280 7:132424088-132424110 GAGAAGGCTGAGACGTTGAAAGG + Intronic
1034229054 7:149505904-149505926 AAGAAGGTGTAAATGCAGAAAGG + Intergenic
1035877161 8:3203496-3203518 AAGAAGGATTAGTGGAAGAATGG + Intronic
1036123486 8:6042732-6042754 AATCATGCTTAGATTTAGAATGG - Intergenic
1038667184 8:29548427-29548449 AAGAAGACTGAGGTTTAGAAAGG - Intergenic
1039186547 8:34923553-34923575 AAAAAGGCTTTACTGTAGAACGG + Intergenic
1040983668 8:53270412-53270434 ATGAAGGGTTAGATGGAAAATGG + Intergenic
1043609273 8:82042168-82042190 AAGAAGGCTTTGAGGAGGAAAGG - Intergenic
1044288720 8:90441928-90441950 AAGAAGGAACAGAAGTAGAAGGG + Intergenic
1045382804 8:101643829-101643851 AAGAAGGGATAGGTGTAGGACGG + Intronic
1045442934 8:102232836-102232858 CAGAAGGCTAAGATGAACAAAGG - Intronic
1045711558 8:104990481-104990503 ATGAAGGCATAGATGAAGAAAGG - Intronic
1046707141 8:117467623-117467645 AAGAAGGAGTATATTTAGAATGG - Intergenic
1047162072 8:122391801-122391823 AAGAAAGGTGAGAGGTAGAAAGG + Intergenic
1048379017 8:133847495-133847517 AAGAAGGTGTGGATGTAGGAAGG - Intergenic
1052030285 9:23620867-23620889 AAGAAGACTTACATCTTGAAAGG + Intergenic
1057944485 9:99313155-99313177 AAAAAGTCCTAGAAGTAGAAGGG + Intergenic
1059222620 9:112639433-112639455 AAGAAGGCTTCCATGTAGGAGGG - Intronic
1060062368 9:120472387-120472409 AAGAGGGCTTGGGTATAGAAAGG + Intronic
1061049790 9:128188149-128188171 AAGAAGGTTTAGATAAACAAAGG + Intronic
1186045930 X:5536673-5536695 AGGAGGGCTAAGTTGTAGAAAGG - Intergenic
1186720307 X:12296821-12296843 AAGAAGGCTGGGATGGGGAAAGG + Intronic
1187692256 X:21881172-21881194 AGAAAGGTTTAGATGTAGAAGGG + Intronic
1189014309 X:37079407-37079429 AAGAAGGATTAAATTTAAAAAGG - Intergenic
1192318317 X:70068225-70068247 AAGGAGGCCTAGGTCTAGAAAGG + Intergenic
1193595229 X:83437686-83437708 AAGAAGCACTAAATGTAGAAAGG - Intergenic
1193907902 X:87264805-87264827 AAGTAGGGATAGCTGTAGAAGGG + Intergenic
1195141696 X:101967252-101967274 AAGGGGAGTTAGATGTAGAAGGG - Intergenic
1196811939 X:119635870-119635892 AAGAATGCTTACATGCAGCATGG + Intronic
1197161626 X:123329720-123329742 AAGAAGGTTTAGGTGAACAAGGG + Intronic
1197353783 X:125409205-125409227 AAGAAGGCAGAAATGGAGAAAGG - Intergenic
1197679420 X:129366387-129366409 AAGAAGGCTGAGAGAAAGAAGGG + Intergenic
1199918401 X:152369927-152369949 AAGAAGGATAAGGTGTAGGATGG + Intronic
1202364573 Y:24148759-24148781 TAGAAGGCTGAGATGTCAAATGG + Intergenic
1202506208 Y:25521363-25521385 TAGAAGGCTGAGATGTCAAATGG - Intergenic