ID: 1124687980

View in Genome Browser
Species Human (GRCh38)
Location 15:31798618-31798640
Sequence ACTCCTGGTTATCCTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124687980_1124687986 28 Left 1124687980 15:31798618-31798640 CCTCACTGAGGATAACCAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1124687986 15:31798669-31798691 AAGTAAACAATGAGGCTCACTGG 0: 1
1: 0
2: 0
3: 14
4: 190
1124687980_1124687984 20 Left 1124687980 15:31798618-31798640 CCTCACTGAGGATAACCAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1124687984 15:31798661-31798683 AGTGCCAAAAGTAAACAATGAGG 0: 1
1: 0
2: 8
3: 96
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124687980 Original CRISPR ACTCCTGGTTATCCTCAGTG AGG (reversed) Intronic
904723058 1:32525197-32525219 ACTCCTGTTTGCCCTCACTGTGG - Intronic
904991045 1:34592894-34592916 ACTCTTGGTTCTCCTCTGAGTGG - Intergenic
909099905 1:71337132-71337154 GCTCCAGATGATCCTCAGTGAGG - Intergenic
911997129 1:104780446-104780468 ACTAGTAGTTATCCTCAATGAGG - Intergenic
916013175 1:160725205-160725227 GCTCCAGATGATCCTCAGTGAGG + Intergenic
917933456 1:179840433-179840455 TCTCCTGCTTTTCCTCACTGAGG - Exonic
920214387 1:204351469-204351491 ACTCCTGGATATGCTCAGGAAGG - Intronic
922612049 1:226938035-226938057 ACTCCTGCTTCTGCTAAGTGGGG - Intronic
1063308456 10:4930118-4930140 GCTCCAAATTATCCTCAGTGAGG + Intronic
1063318217 10:5027364-5027386 GCTCCAAATTATCCTCAGTGAGG - Intronic
1063873320 10:10444112-10444134 ATTCCTACTTATGCTCAGTGTGG + Intergenic
1064288943 10:14015545-14015567 ACTCCTGCTTATCCTTGCTGTGG + Intronic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1064855251 10:19760206-19760228 ACTCCCAGGTATCCTCACTGTGG + Intronic
1068125792 10:52840627-52840649 TCTCCAGGTTATCCTGAGCGTGG + Intergenic
1069070957 10:63990277-63990299 GCTCCAGATGATCCTCAGTGAGG + Intergenic
1070354720 10:75628773-75628795 ACTGCTGTGTCTCCTCAGTGGGG + Intronic
1072089291 10:92111435-92111457 ACATCTGGTTATCCTTAATGAGG + Intronic
1075182308 10:120222597-120222619 TCTCCTGGTTATGCTCAGATTGG + Intergenic
1076461288 10:130649169-130649191 ACTCCTGGTTCTGCACCGTGTGG + Intergenic
1079010588 11:16824989-16825011 ACACCTGGTCATTCTCAGTTGGG + Intronic
1081255116 11:40883147-40883169 AAGCCTGGTTATCTTTAGTGTGG - Intronic
1081275076 11:41138359-41138381 ACTGCAGGTTATAATCAGTGTGG + Intronic
1084799285 11:71531368-71531390 ACGCCTGGTGAGCCACAGTGGGG - Intronic
1085385558 11:76156005-76156027 ACTCATGGCTTTTCTCAGTGTGG - Intergenic
1092061258 12:5552556-5552578 ACTCCTGGGTATCCACACAGAGG + Intronic
1092497236 12:9008980-9009002 GCTCCAAGTTTTCCTCAGTGAGG + Exonic
1095482043 12:42646329-42646351 TCTCCTGGTTTTCCTCCATGAGG + Intergenic
1097133493 12:56831666-56831688 ACTCCAGATGATCCTCAGTGAGG - Intergenic
1097279491 12:57835819-57835841 AGCCCTGATGATCCTCAGTGGGG - Intronic
1099459312 12:82903113-82903135 TCTCCTGGTTATTCTCACTGGGG + Intronic
1100708201 12:97225079-97225101 GCTCCTGGTTCTCCTTAGAGTGG - Intergenic
1103031747 12:117620318-117620340 ACTCCTGTATATCCACAATGGGG - Intronic
1104750662 12:131236114-131236136 AGTCCTGGTGGTCCTCAGTGAGG - Intergenic
1104782061 12:131428346-131428368 AGTCCTGGTGGTCCTCAGTGAGG + Intergenic
1109077698 13:57858734-57858756 ACTCCTTGTCATTCTCTGTGAGG + Intergenic
1114422629 14:22597571-22597593 ACTCCAGGTCACCCTCAGTTTGG - Intergenic
1114434225 14:22690685-22690707 ACTCCTCATTCTTCTCAGTGAGG + Intergenic
1114565243 14:23627060-23627082 GCTCCAGATGATCCTCAGTGAGG + Intergenic
1114613191 14:24055254-24055276 ACTCCCGGTTATCTTCAGCATGG - Exonic
1115335565 14:32241546-32241568 GCTCCAGATGATCCTCAGTGAGG - Intergenic
1116953968 14:50904587-50904609 AATTCTGGTTCTCCACAGTGAGG - Exonic
1121509033 14:94498724-94498746 ACTACGGGGTATCCTCACTGTGG - Intronic
1121721645 14:96112988-96113010 GCTCCAGATGATCCTCAGTGAGG - Intergenic
1122109519 14:99487423-99487445 ACTTCTGGTTTTCCTAACTGGGG - Intronic
1123541089 15:21292393-21292415 GCTCCAGGTCATCATCAGTGTGG - Intergenic
1124687980 15:31798618-31798640 ACTCCTGGTTATCCTCAGTGAGG - Intronic
1125629130 15:41133071-41133093 ACTCCTGTATATATTCAGTGGGG - Intergenic
1126711058 15:51456630-51456652 GCTCCTGAATATCCTCAGGGAGG - Intronic
1127002446 15:54525581-54525603 ACTTCAGGTTAAGCTCAGTGGGG + Exonic
1128279740 15:66385275-66385297 ACACCTGGTTATCCACAGCCAGG - Intronic
1202949402 15_KI270727v1_random:19534-19556 GCTCCAGGTCATCATCAGTGTGG - Intergenic
1138262408 16:55634549-55634571 GCTCCAGATGATCCTCAGTGAGG + Intergenic
1140771349 16:78206987-78207009 ATTCCTTGTTATCCTCATTTTGG + Intronic
1141588430 16:85050680-85050702 ACCCCTTGTTTTCCGCAGTGTGG + Intronic
1143410105 17:6703541-6703563 ACTCCTGCTCATCCTCAAGGAGG - Intronic
1143456169 17:7069504-7069526 GCTCCTGGTTGTCATCTGTGTGG - Intergenic
1143973111 17:10810132-10810154 ACTCCTCCTTTTTCTCAGTGTGG + Intergenic
1147690159 17:42309906-42309928 AGCCCTGGCTATCCACAGTGAGG - Intronic
1148866232 17:50630187-50630209 ACTCCTGTCTCTTCTCAGTGTGG + Intergenic
1149575281 17:57707543-57707565 TCTCTTGGTTCTCCTCAGTTGGG + Intergenic
1150788137 17:68179141-68179163 ACACCAGGTTTTCCTCGGTGAGG - Intergenic
1156568232 18:38220806-38220828 TCTGCTGGTTATTCTCATTGAGG + Intergenic
1157324846 18:46661432-46661454 TCTTCTGTTTATCCACAGTGTGG - Intergenic
1157555938 18:48612893-48612915 CTTCCTGGGTTTCCTCAGTGGGG + Intronic
1160483846 18:79269962-79269984 GCTCCTGCTTATCCTCCTTGCGG + Intronic
1164486974 19:28666857-28666879 AGTCCAGCTTATCCTCAGGGAGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165895680 19:39139561-39139583 ACTCCTGATGGTCCTAAGTGGGG + Intronic
1167415045 19:49365580-49365602 GCTCCTGGTTCTCCTCTTTGTGG - Exonic
925721193 2:6829276-6829298 ACACCTGGTGATCATCACTGTGG - Intergenic
931014949 2:57966049-57966071 ACTCCTTGCCATCCTCTGTGAGG - Intronic
933069074 2:77835464-77835486 GCTCCAGATAATCCTCAGTGAGG + Intergenic
935246638 2:101224578-101224600 ACTCCGGGTTCTCCTCAGCAGGG + Intronic
937323406 2:120974308-120974330 GCCCCTGGTTAGCATCAGTGAGG + Intronic
938708538 2:133955323-133955345 GCTCCTGGGTAGCCTCAGGGTGG + Intergenic
939680356 2:145123703-145123725 ACTGCTGGTTAGCCTCAGTCTGG + Intergenic
941540748 2:166781201-166781223 ACACCTGCTTATTCACAGTGAGG - Intergenic
942919149 2:181349899-181349921 CCTCCTGGTTCTCCTCCCTGAGG - Intergenic
948871061 2:240798446-240798468 TCTCCTGCTTCTCCTCAGTGGGG - Intronic
1172360970 20:34312308-34312330 AGTCCTGGCTCTCCTCAGGGTGG + Intergenic
1175745856 20:61456482-61456504 ACCCCTGCTTATCCCCAGGGTGG - Intronic
1179160034 21:38887554-38887576 CCTCCTGGCCATGCTCAGTGGGG + Intergenic
1181566955 22:23744648-23744670 ACACCTGGTGATCCACACTGGGG - Exonic
1184495064 22:44836058-44836080 ACTGCTTGGTATCCTTAGTGAGG - Intronic
949625197 3:5858031-5858053 ATTACTGGTTATCCTGAGTTGGG + Intergenic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
952034871 3:29188242-29188264 TCTCCTCATTAGCCTCAGTGGGG - Intergenic
956206143 3:66756701-66756723 ACTCTTGGGTAATCTCAGTGTGG + Intergenic
962382703 3:134910328-134910350 TGTCCTGGTTTTCCACAGTGGGG - Intronic
962622000 3:137189640-137189662 CCTACTGGTTGTCCTCACTGTGG + Intergenic
962741013 3:138362548-138362570 TCTGCTGGTTAACCTCAGTGTGG + Intronic
964776194 3:160281115-160281137 GCTCCAGATGATCCTCAGTGAGG + Intronic
965678317 3:171223234-171223256 CCTCCTGGGCTTCCTCAGTGAGG + Intronic
965679222 3:171233277-171233299 AGTGCTGGTTATGATCAGTGGGG - Intronic
966629027 3:182051179-182051201 AGTACTGGTTAATCTCAGTGAGG + Intergenic
967015411 3:185477308-185477330 AATCCTTGTTCTCCTCAGAGTGG + Exonic
978768795 4:112432315-112432337 ACTCCAGCTCATCCTCAGTGTGG + Exonic
984793153 4:183632736-183632758 ACTTCTGGCCATCCTCTGTGAGG - Intergenic
985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG + Intronic
990837067 5:60034045-60034067 ATTCCTGCTTATCCTCTGAGAGG - Intronic
993874061 5:93285742-93285764 TGTCCTGTTTATCCTCAGAGAGG - Intergenic
995253136 5:110017317-110017339 ACTCATGTTCATCCCCAGTGTGG - Intergenic
997296044 5:132769093-132769115 ACACATGGTGGTCCTCAGTGAGG - Intronic
997362490 5:133303947-133303969 ACTCCCTGTTACCCTCAGTTTGG + Intronic
999360058 5:150976652-150976674 ACTTCTGGATATCATCAATGTGG - Intergenic
1001274199 5:170338624-170338646 AATCCTGGTTATCCAGAGAGGGG + Intergenic
1004060762 6:12195667-12195689 ACTACTGGTTGTCCTCAGAAAGG + Intergenic
1004525402 6:16402704-16402726 GCTCCTGGTTAATGTCAGTGAGG - Intronic
1011504154 6:88022670-88022692 ATTCCTGGTTATCTGCATTGTGG - Intergenic
1014300515 6:119675895-119675917 AGTCATGGTTATCTTCAGTCTGG - Intergenic
1014649692 6:124019820-124019842 AATAGTGGTTATCCCCAGTGAGG - Intronic
1021263991 7:18496244-18496266 ACTCCTGTTTTTCCTCAGATGGG + Intronic
1022369893 7:29760631-29760653 AGTCCTTGTTATCCACAGTCAGG + Intergenic
1023280345 7:38562933-38562955 ACTCGTGGCTATGCTCAGTAAGG - Intronic
1024258459 7:47556985-47557007 GCTCCTGGTTATCGTCTGTGGGG - Intronic
1024613268 7:51085184-51085206 TCTCCTCCTTATCCTCAGTGCGG + Exonic
1025117556 7:56271160-56271182 ACTCCTTGTTTTCCTTGGTGTGG - Intergenic
1026201553 7:68218733-68218755 ACTCCTTGTTTTCCTTGGTGTGG - Intergenic
1028948726 7:96610066-96610088 ACTTATGGTTTCCCTCAGTGGGG - Intronic
1031639647 7:124145615-124145637 GCTCCAGATGATCCTCAGTGAGG - Intergenic
1037695237 8:21217674-21217696 GCTCCTGGATAGCCTCAGGGTGG - Intergenic
1039328229 8:36508528-36508550 ACTCTTGGCTTTCCTCAGTTTGG - Intergenic
1040626617 8:49157204-49157226 ACTCCTGGATATGGACAGTGAGG - Intergenic
1042866899 8:73364585-73364607 ACTCGTGGTCATTCTCACTGAGG + Intergenic
1043344669 8:79285868-79285890 GCTCCAGATGATCCTCAGTGAGG - Intergenic
1046487836 8:114909678-114909700 ACTGCTGGAAATACTCAGTGAGG - Intergenic
1048468445 8:134686332-134686354 AGTCCTGGTTATCCTGGGTTGGG + Intronic
1054793262 9:69275528-69275550 ACTCCTTGTCATACTCACTGTGG - Intergenic
1055791357 9:79926423-79926445 ACTCCTGGATAGCCTCAGGATGG + Intergenic
1056816514 9:89805716-89805738 ACTCCTGGGCACCATCAGTGTGG + Intergenic
1058578673 9:106431123-106431145 ATTCCTGGTTATTCTCAGGAGGG + Intergenic
1062094282 9:134695001-134695023 TCGCCTGGTCATCCTCAGAGGGG - Intronic
1062598307 9:137308996-137309018 GCTCCTGGTCATCCTCAGTCGGG - Intronic
1185615520 X:1419449-1419471 TCTCCTGGTTTTCTCCAGTGAGG - Intronic
1185877329 X:3712141-3712163 ACTCCTGTTTGTCCTCATTTTGG - Intronic
1186166814 X:6835232-6835254 GCTCCTGGTAATCATCAGAGTGG - Intergenic
1191608704 X:63088595-63088617 GCTCCAGGTAATCCTCAGTGAGG + Intergenic
1193675206 X:84442661-84442683 ATTCATTGTTAGCCTCAGTGAGG + Intronic
1194169818 X:90566907-90566929 GCTCCAGATAATCCTCAGTGAGG - Intergenic
1194398877 X:93419164-93419186 GCTCCAGATAATCCTCAGTGAGG - Intergenic
1194850632 X:98864619-98864641 GCTCCAGATAATCCTCAGTGAGG + Intergenic
1199553232 X:149079389-149079411 ATTCCTGGTTTTCGCCAGTGTGG + Intergenic
1200516059 Y:4144680-4144702 GCTCCAGATAATCCTCAGTGAGG - Intergenic
1201242292 Y:11970664-11970686 ACTGCTCGTTATACCCAGTGTGG - Intergenic
1201666170 Y:16458520-16458542 ACACATGGGTTTCCTCAGTGAGG - Intergenic
1202151765 Y:21850151-21850173 TCTCCTTCTTCTCCTCAGTGTGG + Intergenic