ID: 1124688004

View in Genome Browser
Species Human (GRCh38)
Location 15:31798767-31798789
Sequence CCACGGCCCCAGAGGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124688004 Original CRISPR CCACGGCCCCAGAGGCCAGA AGG Intronic
900330011 1:2129428-2129450 GCAGGGCCCGAGAGGCAAGACGG + Intronic
900426921 1:2585234-2585256 GCACAGCCCCAGACGGCAGAGGG + Intergenic
900485782 1:2922039-2922061 ACTCGGCCCCAGAGCCCAGATGG - Intergenic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
900970979 1:5992312-5992334 CGACGGACCCAGAGGCCCGGCGG + Exonic
902393329 1:16118909-16118931 CCACGGCCTCAGCAGCCTGATGG - Intergenic
902443164 1:16444512-16444534 CCAAGGCCCCAGAGGTCATGTGG - Intronic
902557819 1:17257293-17257315 CCAGGGCCAAACAGGCCAGAGGG + Intronic
903122818 1:21227382-21227404 GCAAGGCCCCTGAAGCCAGAGGG + Intronic
903654598 1:24941677-24941699 CCAAGGGACCAGAGGCCAGCAGG + Intronic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904608025 1:31709316-31709338 CCACGGCCCCGTAGGGGAGATGG - Intergenic
910197151 1:84653472-84653494 CCACTGTCCCAGTGACCAGACGG + Intronic
912500826 1:110121022-110121044 CCACAGCCACAGCGGCCAGCAGG + Intergenic
915065501 1:153221109-153221131 CCACAGCCACAGAGGCCACAGGG + Intergenic
915491393 1:156251881-156251903 CTCCAGCCCCAAAGGCCAGAAGG + Intronic
915619800 1:157074215-157074237 TGAGGGCCCCAAAGGCCAGAGGG + Intergenic
916186318 1:162137049-162137071 CCAAGGCCCAAGAGGACTGAGGG - Intronic
917617285 1:176758984-176759006 CCAAGGTCCTAGAGGCCAGCAGG + Intronic
917795183 1:178528218-178528240 CCAAGGCCACAGAGCCAAGAGGG - Intronic
920021504 1:202959826-202959848 CCAAGGCCCAACATGCCAGAGGG - Intergenic
920087230 1:203426534-203426556 CCACCGCCTCAGAGGCCAGCAGG - Intergenic
920433998 1:205936563-205936585 CCAGGGCCCCTGAGGCCCGGAGG + Intronic
920637029 1:207713749-207713771 CCACGACCCCGAAGCCCAGAGGG + Intronic
922729329 1:227941745-227941767 CCAGGCCCCCAGAACCCAGAAGG - Intronic
923291621 1:232551656-232551678 CCACAGCCCCAGAGAGCAGGAGG + Intronic
1063771326 10:9205525-9205547 CCACTGCCTCAGATGCCTGATGG + Intergenic
1067774010 10:49148503-49148525 CCATGTCCCAAGAGGCCACAGGG - Intergenic
1072240744 10:93493380-93493402 ACTAGGCCCCAGAGGACAGATGG + Intergenic
1072770728 10:98135050-98135072 CCACGGCCCCGCAGCCCCGAGGG - Intronic
1075174388 10:120145609-120145631 CAACGGCCCCAGAGGCTTCAGGG + Intergenic
1075443096 10:122494720-122494742 CAGCGGCCCCAGCGCCCAGAGGG - Intronic
1075729884 10:124629883-124629905 CCCCTGCCCCTGGGGCCAGAGGG + Intronic
1076421706 10:130336515-130336537 TCAGGGCCCTGGAGGCCAGAAGG - Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1078429813 11:11280359-11280381 CCATGGCCACAGAGGCCATTAGG - Intronic
1078612130 11:12830040-12830062 GCATGGACACAGAGGCCAGAAGG + Intronic
1078820663 11:14877768-14877790 CCAAGGCCCCCCAGGACAGAAGG + Exonic
1078858443 11:15225684-15225706 CAAGGGCCGCAGAGGCCAGTAGG - Exonic
1079686306 11:23363380-23363402 TCACAGGCCCAGAGGCCAGGAGG - Intergenic
1081045141 11:38264648-38264670 CCACGGCCCCTGACACCAGAAGG - Intergenic
1082862422 11:57868665-57868687 CCACAGGCCCAGAGGCCTGGAGG - Intergenic
1083324530 11:61866619-61866641 CCACGTCCCCTGGGGCCAAATGG - Exonic
1083909383 11:65697103-65697125 CTACAGCCCCAAAGGGCAGAAGG - Intergenic
1084007839 11:66332560-66332582 CCAGGGCCCCAGGGGGCAGGCGG + Exonic
1084114458 11:67033616-67033638 CCAAGGTCACAGAGCCCAGAAGG - Intronic
1084551642 11:69846827-69846849 TCTCTGCCCCAGAGGCCACATGG - Intergenic
1084712856 11:70854809-70854831 CCAGGACCCCAGAGGCCATGGGG - Intronic
1084749308 11:71193734-71193756 CCACGCCCCCGGAGGCCAGGAGG + Intronic
1084806295 11:71581523-71581545 CCAAGGCCCCAGAGGAGAGCGGG + Intronic
1085405048 11:76256734-76256756 CCGCCGCCCCAGAGGCAAGGTGG - Intergenic
1085453830 11:76654865-76654887 CCACGGCAGCAGGGGCCAGTGGG - Intergenic
1086805872 11:91241276-91241298 CCACTACCCCAGAGACCAGTGGG - Intergenic
1088906101 11:114156529-114156551 CCAGGGCCCCAGCGGGCAGTGGG - Intronic
1089160895 11:116436389-116436411 ACACTACCCCAGTGGCCAGACGG + Intergenic
1089413138 11:118264167-118264189 CCTTGGCCCCAGAGACCGGACGG + Exonic
1090988060 11:131790510-131790532 TCATGGCCTCAGAGGCAAGAAGG + Intronic
1091193437 11:133713149-133713171 CCATGCCCCCAGAGGCATGAAGG + Intergenic
1091280809 11:134380522-134380544 CCAGGGCCCGAGAGACCTGATGG - Intronic
1092754872 12:11753745-11753767 CTTCTGCCCCAGAGGGCAGACGG + Intronic
1093892128 12:24534840-24534862 ACACATCCCCAGAGTCCAGAGGG + Intergenic
1096504364 12:52083180-52083202 TCATGTCCTCAGAGGCCAGAAGG - Intergenic
1097021016 12:56020925-56020947 CCAAGGCCCCAGAGGTCATGGGG - Intronic
1097615555 12:61880285-61880307 CAAGGGCCTCAAAGGCCAGAGGG + Intronic
1100123379 12:91394995-91395017 TCACAGGCCCAGAGGCCAGGAGG + Intergenic
1101414819 12:104499816-104499838 CCATGGCCACAGGGGGCAGAAGG - Intronic
1101594615 12:106153121-106153143 CCAAGGACCCTGAGGGCAGATGG - Intergenic
1102497629 12:113330358-113330380 CCACCGCCTCACAGGACAGATGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1103156350 12:118688380-118688402 CCAAGGCCCCTGGGGACAGAAGG + Intergenic
1103414949 12:120737545-120737567 CCACTGCTTCGGAGGCCAGAGGG + Intronic
1103705155 12:122867380-122867402 ACCCTGCCCCAGAGGCCAGTGGG - Exonic
1103959477 12:124600018-124600040 GCAAGCCCCCTGAGGCCAGAGGG + Intergenic
1106783058 13:33079079-33079101 CCTGGGCCCCAGAGTTCAGAGGG + Intergenic
1112033227 13:95475599-95475621 CCAGGGGCCCAGAGGCCATTGGG - Intronic
1113766923 13:112887662-112887684 CCACGGCCTCCAAGGCCAGGGGG - Intergenic
1113834846 13:113322053-113322075 CCACAGCCCCTGATTCCAGACGG + Intronic
1115157866 14:30360889-30360911 CCATGGACCCTGAGGCCAGATGG + Intergenic
1115750263 14:36482486-36482508 CCAATACCCCAGAGGACAGATGG + Intronic
1117292214 14:54344789-54344811 TGAGGACCCCAGAGGCCAGACGG - Intergenic
1119435149 14:74593797-74593819 CCACTCCCCCAGAGGCCAGATGG + Intronic
1119482287 14:74965561-74965583 CCAAGGCCCGAGGGGCCAGCTGG - Intergenic
1121648368 14:95536158-95536180 CCAGGGCACCAGGGACCAGATGG + Intronic
1121666367 14:95675491-95675513 CCACAGCCCAAAGGGCCAGAGGG + Intergenic
1121820794 14:96964395-96964417 CCACAGCCCGAGAAGCCACATGG - Intergenic
1122856122 14:104561053-104561075 CCCAGCCCCCAGAGGCCAGCAGG + Intronic
1122942744 14:104989718-104989740 CCAAGGCCCCAGAGGGAGGAGGG + Intronic
1123983593 15:25624691-25624713 CCACAGCCCCAGAGCCAAGCTGG - Intergenic
1124632993 15:31347779-31347801 CCAGGGCCCCAGAGGCTGGAGGG - Intronic
1124688004 15:31798767-31798789 CCACGGCCCCAGAGGCCAGAAGG + Intronic
1125332758 15:38598215-38598237 CCTGGGCACTAGAGGCCAGAGGG - Intergenic
1127484696 15:59408144-59408166 CCACCGCCCAAGATGCCAAAAGG - Intronic
1127561026 15:60136116-60136138 CCACTGGGCCAAAGGCCAGAAGG + Intergenic
1128240305 15:66096885-66096907 CCAAAGCCCCAGAGACCAGCAGG + Intronic
1128511082 15:68314206-68314228 CCACAGCCCCTGAGTCCAGCAGG - Intronic
1129248295 15:74293323-74293345 CCACAGCCCCAGGGGCCACCTGG + Intronic
1129768354 15:78184814-78184836 CCAGGGCCCCAGTGCCCATACGG + Intronic
1132069213 15:98761062-98761084 CCACTGGCACAGAGGCCAGGTGG - Intronic
1132619285 16:856713-856735 CCCAGGCCCCAGCGGCCTGAAGG + Intronic
1132657650 16:1048106-1048128 CCACGGCCTCACAGGCCCCAAGG + Intergenic
1132668660 16:1093953-1093975 GCAGGGCCGCAGAGGCCAGAAGG - Exonic
1132685921 16:1162092-1162114 CCACACACCCAGAGGCCAGGAGG - Intronic
1132932607 16:2466694-2466716 CCACGGCCTCTGTGGCCAGCAGG - Intergenic
1133744729 16:8677381-8677403 CCACAGACCCTGAAGCCAGATGG + Intronic
1137446319 16:48534723-48534745 CCACCTCCGCAGAGGCCAAATGG + Intergenic
1137595760 16:49722482-49722504 CCACATCCCTAGAGCCCAGAGGG + Intronic
1137716996 16:50604052-50604074 CCACTGTCCTGGAGGCCAGAGGG + Intronic
1137983686 16:53090649-53090671 CCAGGGCCCCAGAGTCCTGCCGG + Intronic
1139711125 16:68777221-68777243 CCACGGGCTCTGGGGCCAGACGG + Intronic
1139853770 16:69965413-69965435 CCACGGCCGCAGCGCCCGGAGGG + Intergenic
1141496602 16:84414718-84414740 GCAAAGCCCCTGAGGCCAGAAGG + Intronic
1141698963 16:85633719-85633741 CCCCGTCCCCAGAGTCCAGCTGG - Intronic
1141771974 16:86094902-86094924 CCACGCTCCCAGCAGCCAGAGGG - Intergenic
1142339751 16:89513672-89513694 TCACAGCCCCAGGGGGCAGAAGG + Intronic
1142975352 17:3640395-3640417 CCACCACCCCAGTGGCCACATGG - Intronic
1142995421 17:3757208-3757230 GGAGGGCCCCAGAGGCCAGATGG - Intronic
1144675284 17:17158035-17158057 CCACAGCCTCAGAGGCAGGACGG - Intronic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1147363227 17:39944320-39944342 CCACGGGCACTGAGGCCAGCTGG - Exonic
1147844115 17:43392959-43392981 CCAAGGACTGAGAGGCCAGAGGG - Intergenic
1148114756 17:45169162-45169184 CCCCGGACCCAGAGCCCAGGGGG + Exonic
1148152568 17:45405194-45405216 CCACAGCCTCAGGGACCAGAAGG - Intronic
1148152585 17:45405264-45405286 CCACAGCCCCAGGGACCAGAGGG - Intronic
1148748349 17:49930910-49930932 CCTCTCCCCTAGAGGCCAGAGGG + Intergenic
1150078428 17:62214235-62214257 CCATTGACCCAGAGGCCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150416804 17:64994886-64994908 ACCCGGCCACGGAGGCCAGAGGG + Intergenic
1150440042 17:65183710-65183732 CCACGGAGCCAAAGGCGAGATGG - Intronic
1151764096 17:76123141-76123163 CCTGGGCCCCTGAGGGCAGAGGG + Intergenic
1152828725 17:82484131-82484153 CCACTGCCCCATAGACCACACGG - Intronic
1154167782 18:12028878-12028900 CCGCGGCCCCTGAGGCCAGGTGG - Exonic
1154491536 18:14925795-14925817 CCCCGGACCCAGAGGCCCGAGGG + Intergenic
1156350677 18:36298453-36298475 CAGCGGCCCCAGAGGCCTGAGGG - Intronic
1160958576 19:1706760-1706782 CCAGGGCCCGGGAGGCCAGGTGG - Intergenic
1161086507 19:2338008-2338030 GCACGGCCCCACCGGCTAGAGGG - Intronic
1161216529 19:3097430-3097452 CCTGGGCCCCAGATGCCACAGGG - Intronic
1161455197 19:4366442-4366464 CCTCTGACACAGAGGCCAGAGGG + Intronic
1161469093 19:4447518-4447540 CCTGGGCCCCGGGGGCCAGAAGG + Intronic
1161570085 19:5025668-5025690 CTAAGGCCCCAGAGGCCGGATGG - Intronic
1161651729 19:5489967-5489989 CCACAGCACCACAGCCCAGAGGG + Intergenic
1162015182 19:7841711-7841733 CCCCAGACCCAGAGGCCAGTGGG + Intronic
1162042751 19:7980368-7980390 CCACGAACCCAGGAGCCAGAAGG + Intronic
1162851963 19:13437878-13437900 CCAAAGCCCCAGTGGACAGAGGG + Intronic
1163054215 19:14706185-14706207 CCCTGGACACAGAGGCCAGAGGG + Intronic
1164720582 19:30429022-30429044 CCAGGGCACCTGAGGCCACATGG + Intronic
1165823607 19:38692976-38692998 CCAGGTACCCGGAGGCCAGACGG - Intronic
1167119035 19:47505825-47505847 GCACAGCCCCAGAAGGCAGAGGG - Intronic
1167299668 19:48671531-48671553 CCAGGCACCCAGAGGCCACAGGG + Intronic
1167787026 19:51645444-51645466 TCACAGCCCCAGAGGGAAGAGGG + Intronic
925117932 2:1396190-1396212 ACATGGCCACAGAGGCCAGCAGG + Intronic
925610227 2:5696308-5696330 CCACGGCCCCGGGGGACAGAAGG - Exonic
926117268 2:10221390-10221412 CCCAGGCCTCAGAGGCCAGCGGG + Intergenic
926309646 2:11666236-11666258 CTGCTGCCCCAGAGGCCACAGGG + Intronic
926467185 2:13205800-13205822 CCACAGGCCCAGAGGCCTAATGG + Intergenic
927197043 2:20555263-20555285 CCACGGCTTAAGAGGCCAGGTGG + Intergenic
927287597 2:21372551-21372573 CCACCACCCCAGAGGAGAGATGG - Intergenic
930053788 2:47236793-47236815 CCAAGGCCACACAGGACAGATGG + Intergenic
932859815 2:75278435-75278457 CCACGGGCCCTGGGCCCAGAAGG - Intergenic
934776536 2:96941491-96941513 CCAAGGCCCCAGTGGCCACGAGG + Intronic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
937912272 2:127081461-127081483 CCTCGGCCCCAGAGACCAGTGGG + Intronic
937975114 2:127577616-127577638 CCACCGCCTCTGAGGACAGAGGG - Intronic
938408882 2:131047622-131047644 CCCTGGCCACAGAAGCCAGAAGG + Intergenic
940183646 2:150960272-150960294 CCCTAGACCCAGAGGCCAGAAGG + Intergenic
944137441 2:196414662-196414684 CAGGGGCCTCAGAGGCCAGATGG - Intronic
945193407 2:207213762-207213784 CCAGGGCACCAAAGTCCAGAGGG - Intergenic
947807247 2:232977298-232977320 CCAGGCTCCCAGAGGTCAGATGG - Intronic
948468033 2:238161484-238161506 CCAGGGTCCCAGAGTACAGAAGG + Intronic
948763763 2:240209005-240209027 GCAGGGCCCAAAAGGCCAGAGGG + Intergenic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169074632 20:2752996-2753018 CCAGGACTCCAGAGGCCAGGTGG + Intronic
1171385888 20:24769358-24769380 CCTGGGTCCCAGAGGCAAGAGGG - Intergenic
1172612604 20:36262877-36262899 TCATGACCCCAGAGGCCAGTGGG - Intronic
1174104979 20:48155546-48155568 CCAGGCCCCAAGAGGCCAGGAGG - Intergenic
1175118111 20:56697821-56697843 TCACCGGCCCAGACGCCAGAGGG - Intergenic
1175169949 20:57073219-57073241 CCACGGCCACCCAGGGCAGAAGG + Intergenic
1175786061 20:61712440-61712462 CCACTGCCCTAGAGGGGAGAAGG + Intronic
1175908574 20:62393862-62393884 CCACCAGCACAGAGGCCAGAGGG + Intronic
1175933896 20:62506311-62506333 CTAGGGCCCCAGAGGCCACTGGG + Intergenic
1175934194 20:62507592-62507614 GCATGGCCCCGGAGGCCAGCTGG - Intergenic
1175969264 20:62675658-62675680 GCCCTGCCACAGAGGCCAGAAGG + Intronic
1176168596 20:63687109-63687131 CCACGGCCGCCGTGGCCAGTCGG + Intronic
1179615586 21:42581084-42581106 CCATGGCCCCGGAGGGCAGCAGG - Exonic
1180972461 22:19822605-19822627 CCACTGTCCCAGAGCCCAGTGGG - Intronic
1181039057 22:20183438-20183460 CCAGGGCCACACAGGGCAGACGG - Intergenic
1181495503 22:23285283-23285305 CCTGGGGCCCAGAGGCCTGACGG - Intronic
1181759894 22:25051077-25051099 CAGGGGCCTCAGAGGCCAGAAGG - Intronic
1183185199 22:36287897-36287919 CCATCGCCCCAGAGCCCAGAAGG + Intronic
1183409535 22:37646826-37646848 CCGAGGCCCCAGCAGCCAGACGG - Exonic
1183466765 22:37983980-37984002 CGTGGGCCCCAGGGGCCAGATGG - Intronic
1183588783 22:38768141-38768163 ACAGGGCCCCTGAGGGCAGAGGG - Intronic
1183685847 22:39361035-39361057 GCAGGGCCCTAAAGGCCAGATGG - Intronic
1183780144 22:39994560-39994582 CGGCGGCCCCAGAGGCCACTGGG + Intergenic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184335901 22:43852941-43852963 CCAGGGCCACAGAGGCCAGTGGG + Intronic
1184356415 22:43983167-43983189 CCGCGGCCTCAAAGGTCAGAGGG + Intronic
1184827854 22:46965282-46965304 CCCCGCCCCCACAGGTCAGATGG - Intronic
1184916832 22:47575087-47575109 GAATGGCCCCAGAGGACAGAGGG + Intergenic
1185167159 22:49268545-49268567 GCATGGCTCCAGATGCCAGATGG - Intergenic
1185419637 22:50728309-50728331 CCACGGAGCCAGGGGCCCGAGGG - Intergenic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
950423311 3:12911149-12911171 CCCAGGCAACAGAGGCCAGAGGG + Intronic
951663345 3:25095051-25095073 TCACTGGACCAGAGGCCAGAAGG - Intergenic
953393771 3:42550091-42550113 CCACGGGGCCAGAGCCCAAAAGG - Intronic
953575135 3:44107217-44107239 CCTGGGCCACAGAGGCCAGAGGG + Intergenic
954342659 3:49967939-49967961 CCCCGGCCCCTGAAGTCAGATGG - Exonic
956751217 3:72345488-72345510 CCACAGCCCAGGAGGCCAGTAGG + Intergenic
961270087 3:125681761-125681783 CCATGGCCCCAGTGGAGAGAGGG - Intergenic
961653323 3:128428253-128428275 GCACGGTCACAGAGGCCAGCAGG + Intergenic
963837762 3:150074217-150074239 CCCCTGCCACAGATGCCAGAGGG - Intergenic
966892383 3:184416888-184416910 CCCAGGCCCCAGCAGCCAGAGGG + Intronic
966899070 3:184467393-184467415 CCCAGGCCCCAGCAGCCAGAGGG + Intronic
966991217 3:185232797-185232819 CCTCAGCCACAGAGGCCAGAAGG + Intronic
968061574 3:195730002-195730024 CCTTTGCCTCAGAGGCCAGAAGG - Intronic
968503118 4:960319-960341 CCAGGCCCCCACAGGGCAGAGGG + Exonic
968548656 4:1211246-1211268 CCACAGACCCAGTGGGCAGAGGG + Intergenic
968649650 4:1755454-1755476 CCACAGCCCACGAGGCCACAGGG + Intergenic
969525377 4:7701533-7701555 CCACGGCCTCAGGGCCCCGAAGG - Intronic
976084693 4:81395356-81395378 CCACGGCCCCAGATGCCTTGAGG - Intergenic
976712576 4:88087918-88087940 CCACAAGCCCTGAGGCCAGAAGG + Intergenic
977503984 4:97878668-97878690 TCACAGACCCAGAGGCCAGGAGG - Intronic
985539670 5:482128-482150 CCACTGCACCAGAGGCTTGATGG + Exonic
985621734 5:959634-959656 CCACGGCCCCAGTGGTCAGCGGG + Intergenic
985660653 5:1155365-1155387 CCGCGGCTGCAGAGTCCAGACGG - Intergenic
985680761 5:1254452-1254474 GCACGGCCTCGGAGGGCAGAGGG + Exonic
985973330 5:3394184-3394206 CCAGGGCCACAGAGGCAAGATGG + Intergenic
988487105 5:31676367-31676389 CGAAGGCCTCAGAGGTCAGAAGG + Intronic
989139535 5:38189239-38189261 CCCAGGCCCCGGAGGTCAGACGG - Intergenic
992174054 5:74132654-74132676 CCACAGCCCCAAAGGCCGGCTGG - Intergenic
992717832 5:79529290-79529312 CCACCGCCCAAGATGCCAAAAGG + Intergenic
995911737 5:117196059-117196081 CCAAGCCCCCAGAGGCAAAAAGG - Intergenic
997212901 5:132087923-132087945 TCCAGGCCCCAGAGGCCTGAGGG + Intergenic
997599614 5:135130343-135130365 CAAAGGCCACAGAGGCCAAAAGG - Intronic
998506948 5:142679708-142679730 CCAAGGCCCAAGAGGGAAGAAGG - Intronic
999101225 5:149027715-149027737 CCACAGCCTCAGAGGCAGGAGGG + Exonic
999240369 5:150124218-150124240 CCACTGCCCCAGAGGCCTCAGGG - Intronic
999252304 5:150190168-150190190 CCACGCCCGCAGCCGCCAGACGG + Exonic
1002210626 5:177596820-177596842 CAAAGGGCCCAGAGGCCAGAGGG - Intergenic
1002421837 5:179153106-179153128 CCACGGACGCAGAGGCCTGGAGG - Intronic
1002457497 5:179353951-179353973 CCACAGGCCCAGGGGCCAGGTGG - Intergenic
1002927208 6:1611438-1611460 ACGCGGCCGCCGAGGCCAGAAGG - Exonic
1003149772 6:3538646-3538668 CCATGGACACAGAGCCCAGATGG + Intergenic
1003431540 6:6043278-6043300 TCACGGCCCCAGAGGTGAGAGGG + Intergenic
1003872343 6:10412896-10412918 CCCCGGCCCCAGAGAGCCGAGGG - Intronic
1006515204 6:34541788-34541810 CACAGGCCCCAGAGGCCAGGAGG + Intronic
1007293149 6:40802056-40802078 CCACTGCCCCTGGGGCCAGCTGG + Intergenic
1007572924 6:42906194-42906216 CCAGGGCACCAGAGGCCAAGAGG + Intergenic
1012064922 6:94537781-94537803 TCACAGGCCCAGAGGCCAAATGG - Intergenic
1013412853 6:109897290-109897312 CCACCTCCCCAGAGACCAGGAGG - Intergenic
1014576704 6:123082414-123082436 TCACAGGCCCAGAGGCCAGGAGG - Intergenic
1017858873 6:158376665-158376687 CCACAGCCTCAGAGGCTGGAAGG + Intronic
1018972377 6:168538247-168538269 CCACTGCCCCAGATTCCAGCAGG - Intronic
1019277562 7:183880-183902 CCACGGCCCCCCAGGACAGAGGG - Intergenic
1019491597 7:1316331-1316353 CCACGGCCCCAGGGCCCACAGGG - Intergenic
1019517008 7:1444577-1444599 GCGGGGCCCCGGAGGCCAGAGGG - Intronic
1019607985 7:1919569-1919591 GCACGGGCCCAGAGGCCAATGGG + Intronic
1020084438 7:5302978-5303000 CCAGGGGCCCCGAGGCCTGAGGG + Exonic
1020098906 7:5383476-5383498 AGCCGCCCCCAGAGGCCAGAGGG + Intronic
1020255507 7:6500961-6500983 CCACTGCCCCAGAGGACAGATGG + Intronic
1020366027 7:7381543-7381565 CCATGGCCTCCCAGGCCAGAAGG - Exonic
1023779092 7:43639507-43639529 CCACCACCCCAGTGGCCATATGG + Exonic
1023870408 7:44260325-44260347 CCTAGGCCCCAGAAGCCACATGG - Intronic
1025209856 7:57014221-57014243 CCAGGGGCCCCGAGGCCTGAGGG - Intergenic
1025501230 7:61301619-61301641 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025516090 7:61647842-61647864 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025540427 7:62076668-62076690 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025662095 7:63562630-63562652 CCAGGGGCCCCGAGGCCTGAGGG + Intergenic
1029183516 7:98721622-98721644 CCACAGCCCCTGGAGCCAGAAGG + Intergenic
1029992817 7:104977491-104977513 ACACTGCCCAAGAAGCCAGATGG - Intergenic
1030589844 7:111467125-111467147 GCACAGCCCCTGAGGCGAGAAGG + Intronic
1031150238 7:118045761-118045783 GCATGGCCCAAGAGGCCAGATGG - Intergenic
1033598057 7:142870542-142870564 CCAGGGCCACAGGGGTCAGAAGG - Exonic
1034421646 7:150993901-150993923 CCCCGGCCCCTGAGCCCAGCCGG + Exonic
1034431884 7:151045299-151045321 CCACCGCCCAAAAAGCCAGAAGG + Exonic
1035742190 8:1936916-1936938 CCACGTCTCCAGGGGCCAGCCGG - Intronic
1037598613 8:20374714-20374736 CCATGCCCCCAGTGGCCAAAGGG - Intergenic
1040547332 8:48408949-48408971 CCACAGCCCCTGTGTCCAGATGG + Intergenic
1042437309 8:68782624-68782646 TCACTGCCCCAGGGGTCAGAAGG - Intronic
1047615095 8:126557223-126557245 CCGCCGCCTCAGGGGCCAGATGG - Exonic
1048164293 8:132048770-132048792 CCACGGCCACAGAGCACAGCAGG + Intronic
1048804888 8:138230761-138230783 CTACAGCACCAGAGGCCAAAGGG + Intronic
1049499364 8:142953370-142953392 CCACAGCCCCACAGGCTACAGGG + Intergenic
1049512908 8:143038787-143038809 CCACTCTCACAGAGGCCAGACGG - Intergenic
1049576884 8:143393684-143393706 CCATGGACCCAGAGGCCTGAGGG - Intergenic
1049671657 8:143872773-143872795 CCAGGCCCCCAGTGGCCAGTTGG + Exonic
1049961517 9:742264-742286 CATCAGCCCCACAGGCCAGAAGG - Exonic
1053285538 9:36847604-36847626 CCCCCTCCCCAGTGGCCAGAAGG - Intronic
1053429409 9:38032299-38032321 CCAAGGCCTCAGAGCACAGAAGG + Intronic
1055603746 9:77947133-77947155 CCAACTCCCCAGAGGCCAGCTGG + Intronic
1055709374 9:79043082-79043104 CCAGGGTTCCAGAGGCCAGCAGG - Intergenic
1056291745 9:85150483-85150505 CAACAGCTTCAGAGGCCAGAAGG + Intergenic
1056822924 9:89856274-89856296 ACAGGGCCCTAGAGGCCAGATGG + Intergenic
1057384319 9:94593902-94593924 CCACAGTCCCCGAGGCCAGAGGG - Intergenic
1057943638 9:99306122-99306144 CGAGGGCCTCAAAGGCCAGAGGG + Intergenic
1059291693 9:113230977-113230999 CCTCTGCCCCAGAGGCTATAGGG - Intronic
1059305525 9:113350328-113350350 TCACCGCACCAGAAGCCAGAAGG - Intronic
1059331755 9:113539947-113539969 CCACGGGCCCAGTGCCCAGATGG - Intronic
1060995623 9:127873683-127873705 CCACAGCCCCACTGGGCAGAGGG + Intronic
1061040046 9:128136004-128136026 CAAGGGCCCTAGAGGCCAGATGG - Intergenic
1061284485 9:129614250-129614272 CCAAGGCCCCAGAAGCAGGATGG - Intronic
1061667083 9:132166867-132166889 CATAGTCCCCAGAGGCCAGAGGG - Exonic
1061720070 9:132546037-132546059 CCTTGTCCCCAGAGGCCAGCAGG + Intronic
1062052796 9:134456192-134456214 CCAGGGCCGCAGCGGCCGGAAGG + Intergenic
1062159734 9:135073721-135073743 CCACGGCCCCTGAGGCAGGGTGG - Intergenic
1062393774 9:136344381-136344403 TCACGGCTCTGGAGGCCAGAAGG + Intronic
1062452903 9:136622969-136622991 CAACGGCCCCAGAGCCCACCAGG - Intergenic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1187050093 X:15687335-15687357 CTACGGCCCCAGAGGACATTTGG - Intergenic
1192313144 X:70032761-70032783 CCAGGGCCCCATAGGTGAGAGGG - Intronic
1195757969 X:108218072-108218094 AAACGGCCCCAGAGTCCAGCTGG - Intronic
1197082969 X:122440944-122440966 CCATGGCCCCAGGTGCCAGTGGG - Intergenic
1198458250 X:136838447-136838469 TCAAGGCCCCAGAGCCCAGGTGG + Intergenic
1199113322 X:143959670-143959692 TCACAGTCCCAGAGGCCAGGAGG - Intergenic
1199971263 X:152863640-152863662 CCACAGCCCCAGCAGCCTGAAGG - Intronic
1199984151 X:152938313-152938335 CCCTGGCCCCAGAAGCCAGAGGG - Intronic