ID: 1124693155

View in Genome Browser
Species Human (GRCh38)
Location 15:31842562-31842584
Sequence GGGGCTGGTGGGGGACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1382
Summary {0: 1, 1: 0, 2: 12, 3: 183, 4: 1186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124693141_1124693155 27 Left 1124693141 15:31842512-31842534 CCTCTGATGGCTGGTTTCAATGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG 0: 1
1: 0
2: 12
3: 183
4: 1186
1124693140_1124693155 28 Left 1124693140 15:31842511-31842533 CCCTCTGATGGCTGGTTTCAATG 0: 1
1: 0
2: 2
3: 105
4: 167
Right 1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG 0: 1
1: 0
2: 12
3: 183
4: 1186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124693155 Original CRISPR GGGGCTGGTGGGGGACAGAG AGG Intronic
900318883 1:2072842-2072864 GGGGGTGCAGAGGGACAGAGGGG - Intronic
900345665 1:2209162-2209184 GCAGCAGGTGGGGGACGGAGTGG - Intronic
900435938 1:2631382-2631404 GGGGGCGGTGGGGTACAGGGGGG - Intronic
900504409 1:3022145-3022167 GGGCCTGGTGGTGGACAGCGGGG + Exonic
900520325 1:3102242-3102264 GGGGCTGGGAGGGGACTCAGGGG + Intronic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900582526 1:3416081-3416103 GGGGCTGGAAGGGGCCAGAGGGG + Intronic
900591235 1:3460929-3460951 GGGGCTGAGCAGGGACAGAGGGG + Intronic
900613284 1:3553405-3553427 GGGGCTGGTGGGGGGCGGGAGGG - Intronic
900625939 1:3608646-3608668 GGTGCTGCTGGGCTACAGAGAGG - Intronic
900638374 1:3676458-3676480 GGGGATGCTTGGGGACAGGGAGG + Intronic
900640940 1:3687801-3687823 TGGGCAGGTGGGCCACAGAGCGG + Intronic
900648781 1:3720963-3720985 GGGGCTGGTGAGGGGCACAGAGG + Intronic
900796081 1:4709215-4709237 GGGGCTGGTGGGGGCTGGTGGGG + Intronic
900796090 1:4709235-4709257 GGGCCTGGTGGGGGCCGGTGGGG + Intronic
900987052 1:6079159-6079181 GGGGCTGGTGTGGGCCAGGGAGG - Intronic
901055197 1:6445978-6446000 TGGGCTGATGGGGGCCAGTGAGG + Intronic
901174132 1:7286155-7286177 CCTGCTGGTGGGGGGCAGAGAGG + Intronic
901203222 1:7478395-7478417 GGGGATGGTGTGGAGCAGAGAGG - Intronic
901434453 1:9238163-9238185 GGACCTGGTGGGGGACATGGGGG + Intronic
901493307 1:9607577-9607599 GGGGCTGGTGGGGAAAAGGCCGG - Exonic
901512562 1:9724722-9724744 GGGGCTGGTTGGATGCAGAGCGG + Intronic
901642648 1:10700743-10700765 GCTGATAGTGGGGGACAGAGAGG + Intronic
901764393 1:11490687-11490709 GGGGCAGGAGGTGGCCAGAGAGG + Intronic
901769933 1:11524894-11524916 AGGGATGGTGGGGGAGATAGTGG - Intronic
901771854 1:11534594-11534616 GGGGCCGGGAGGGCACAGAGCGG + Intronic
902534827 1:17113592-17113614 GTGCCTGGTGTGGGGCAGAGGGG + Intronic
902549029 1:17208436-17208458 GGGGTGGGTGGTGGACAGGGTGG - Intronic
902573044 1:17359209-17359231 GGTGGGGGTGGGGGACAGTGTGG - Intronic
902737151 1:18408764-18408786 GGGGATGGTGGCAGAGAGAGGGG + Intergenic
902792276 1:18777605-18777627 GGGGTTGGGGGGGGGCAGGGAGG - Intergenic
903008720 1:20315517-20315539 GGGGATGGAAGGGGACAGAGTGG + Intronic
903143481 1:21354725-21354747 GGGGCTGTGGGGGCACAGACGGG - Intergenic
903275972 1:22222196-22222218 GGGGATGTGGGGGGACAGGGGGG - Intergenic
903364319 1:22796551-22796573 GGGGGATGGGGGGGACAGAGAGG - Intronic
903606746 1:24580406-24580428 AGGGGTGGAGGGGGGCAGAGTGG + Intronic
903774059 1:25781687-25781709 GGGGGTGGTGGGGGAGATAGGGG - Intronic
904004541 1:27356915-27356937 GGGGCCGGTGGGGGCCAGGCGGG - Intronic
904198843 1:28806035-28806057 GGGGCTGGTGAGGTAGAGAGAGG + Intergenic
904334082 1:29785773-29785795 GGGGGTGGTGAGGGCCATAGTGG - Intergenic
904370346 1:30044137-30044159 TGGGCTGGTGGGGGCCAGGCAGG - Intergenic
904435202 1:30490477-30490499 GGTGCTGGTGTGGAACAGATGGG + Intergenic
904842141 1:33379447-33379469 GGGGATGGTGGGGGGCGGGGGGG - Intronic
904939166 1:34152881-34152903 GGGGCTGGGGAGGGAGAGATGGG - Intronic
905199781 1:36307751-36307773 AGGCCTAGTGGGGGACAGTGAGG - Exonic
905300410 1:36982815-36982837 GGGGGTGGTGGGGGAAGGAGGGG + Intronic
905391695 1:37639842-37639864 TGTGTTGGTGGGGGACAGAGTGG - Intergenic
905405369 1:37728827-37728849 GGGTCTGGGTGGGGATAGAGGGG + Intronic
906083108 1:43107457-43107479 GGGGAGGGAGGGGGGCAGAGGGG + Intergenic
906083132 1:43107499-43107521 GGGGGTGGTGGGGGGTAGGGGGG + Intergenic
906110313 1:43318086-43318108 GGGGCGGGTGGAGGCCAGAGGGG + Intronic
906140434 1:43531099-43531121 GGGGCTGGTGGGGGGCCGGGGGG - Intronic
906164271 1:43674228-43674250 GGGGGCGGTGGGGCACACAGTGG - Intronic
906680630 1:47723454-47723476 GGGGCTGCTAGGGGGCTGAGGGG + Intergenic
906680996 1:47725382-47725404 TGGGCTGGGGGAGGCCAGAGGGG - Intergenic
906725253 1:48039860-48039882 GGGGCGGGGAGAGGACAGAGAGG + Intergenic
906769585 1:48472072-48472094 GGGGCTGGGCGGGGACGGGGAGG + Exonic
907091405 1:51729479-51729501 GGCGCTGCTGGGGGAAAGGGAGG - Intronic
907192392 1:52660312-52660334 GGAGCTGTTGGGGGGCAGGGAGG - Intronic
907230468 1:52993771-52993793 GGTGCTGGGGGAGGAGAGAGGGG - Intronic
907290725 1:53411010-53411032 GTGGCTGGTGGGGGAGAGCAGGG + Intergenic
907332152 1:53678332-53678354 GGGGGGGGTGGGGGGCAGGGGGG + Intronic
907396859 1:54196968-54196990 GGGAGTGTGGGGGGACAGAGGGG + Intronic
907758318 1:57332863-57332885 GTGGCTGGTGGGAGGCAGACAGG - Intronic
907890289 1:58630709-58630731 AGGGCTGGTGAGGGGCTGAGAGG - Intergenic
908127325 1:61044061-61044083 GGGCCTGGTGGGTGACAGTGAGG + Intronic
908393283 1:63702795-63702817 GGGGCTGGAGTGGGAGAGGGAGG + Intergenic
908605555 1:65793341-65793363 GGGGCTGATGTGGGGCAAAGAGG + Intronic
908813883 1:68011938-68011960 GGGTTTGGTGGTGAACAGAGGGG - Intergenic
908827957 1:68151724-68151746 GGGGCTGGTGGGTGGTGGAGAGG + Intronic
909975504 1:82042048-82042070 GGGGCTGGAGGAGGAAGGAGCGG - Intergenic
910349457 1:86278551-86278573 GGGGGTGGAGTGGGACACAGTGG + Intergenic
910449235 1:87329493-87329515 GGGGCTGGTGGGGACCGTAGAGG + Intronic
910941500 1:92539866-92539888 GGGGTTGGAGGGGAAGAGAGGGG - Intronic
912497277 1:110099751-110099773 GGGGGTGGTGGGAGAAAGATGGG + Intergenic
912624659 1:111197250-111197272 CAGGCTGGGGAGGGACAGAGAGG + Exonic
913332650 1:117680188-117680210 GGGGCCGGTGGGGGACAAGAGGG - Intergenic
913379525 1:118193850-118193872 GGGACTGGTGGGGAATAAAGAGG + Intergenic
914213619 1:145604777-145604799 GGGGCTGGTGGGGGATAGTCGGG + Intergenic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915107984 1:153546148-153546170 GGGGGTGGTGGGTGACAGGTGGG + Intronic
915145758 1:153795035-153795057 TGGGCCGGTGGGGGAGGGAGGGG + Intergenic
915325399 1:155079182-155079204 GGGGCTGGGAGGGGACGGAGAGG + Intronic
915337153 1:155151429-155151451 TGGGGGGGTGGGGGAGAGAGGGG - Intergenic
915356018 1:155255484-155255506 GGGGATGGTGCGGGAAGGAGGGG + Intergenic
915514890 1:156406869-156406891 GGTGCTGATGGGGCACAGAAGGG + Intronic
915981615 1:160423995-160424017 GGGTGGGGTGGGGGAAAGAGAGG + Intronic
916118247 1:161506318-161506340 GGAGCTGCTGAGGGGCAGAGTGG - Exonic
916605948 1:166342996-166343018 GGGGGTGGCGGGGGAGAGTGGGG + Intergenic
916678379 1:167083078-167083100 AGAGCTGGTGGAGGACATAGTGG - Intronic
916747928 1:167698563-167698585 GGAGCTGGTGGGGAGCAGACAGG - Intronic
916811229 1:168307378-168307400 ATGGATGGTGGGGGAAAGAGGGG + Intronic
916830432 1:168485391-168485413 GGGGGTGGTGGGGGGCGGCGTGG + Intergenic
916875707 1:168966439-168966461 GGGGCTGCTTGGTGAGAGAGAGG - Intergenic
916919768 1:169452068-169452090 GGGGCAGGGGGAAGACAGAGAGG + Intronic
917080744 1:171254694-171254716 GGGGCTGGAGGTGGTCACAGAGG - Intronic
917971228 1:180209088-180209110 GGGGCTGGAGGGGGGAATAGAGG + Intergenic
918326097 1:183412061-183412083 GGTGGAGGTGGGGGGCAGAGTGG + Intronic
918545194 1:185674444-185674466 AGGGGTGGAGGGGCACAGAGAGG - Intergenic
918879298 1:190094816-190094838 GGGCGGGGTGGGGGAGAGAGAGG + Intergenic
919796901 1:201326383-201326405 GGGAGGGGTGGAGGACAGAGAGG - Intronic
919829312 1:201529184-201529206 GGGGATGGAGGGGGAAAGAGAGG - Intergenic
919922317 1:202174036-202174058 CAGGCTGGTGGGGGGCAGGGTGG + Intergenic
919974699 1:202602970-202602992 AGGGCTGTGGGGGGGCAGAGTGG - Intronic
920091457 1:203455902-203455924 GGAGCTGGTGGGGCGCAGGGTGG + Intergenic
920172914 1:204082671-204082693 GGGGCTTGTGGGGCAGGGAGAGG + Intronic
920176496 1:204105000-204105022 TGGGTTGGTGGGGTTCAGAGGGG + Intronic
920221564 1:204406899-204406921 AGGGCTGGTGGGGGATTGGGGGG - Intronic
920230132 1:204464698-204464720 TGGGCTGAGTGGGGACAGAGGGG - Intronic
920230446 1:204466484-204466506 GGGGGTGGGGGTGCACAGAGGGG + Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920467901 1:206203719-206203741 GGGGCTGGGGCGGGAAGGAGAGG + Intronic
920649035 1:207823199-207823221 GAGGCTGGTGGGGAGCCGAGTGG - Intergenic
920747727 1:208644755-208644777 GGAGCTGCTGGGGGAGGGAGTGG - Intergenic
921166970 1:212514584-212514606 GGGGCGGTTGGGGGTCAGGGAGG + Intergenic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921685702 1:218086766-218086788 TGGGCTGGTGGTGGACTGTGGGG - Intergenic
921805291 1:219447021-219447043 GGGGCGGGTGGGGGGCACGGTGG - Intergenic
922199894 1:223393206-223393228 GGGTCGGGTGGGGGAGAGAGGGG - Intergenic
922452172 1:225746181-225746203 GAGAGTGGGGGGGGACAGAGGGG - Intergenic
922478068 1:225920503-225920525 TGGGCTGGAGGGGGTCAGTGTGG + Exonic
922579307 1:226685318-226685340 GGGGCAGGGGTGGGGCAGAGCGG - Intronic
922880862 1:228979430-228979452 GTGGGTGGTGTGGCACAGAGTGG - Intergenic
923377784 1:233382346-233382368 GGAGCAGGTGAGGGGCAGAGTGG - Exonic
923558460 1:235020550-235020572 GAGGCTGGGGGGTGACAGATGGG + Intergenic
923596014 1:235361344-235361366 GGGCCTGATTGGGGACAGAGAGG - Intergenic
924033460 1:239910725-239910747 GGGGCTGTTTGGGGAGAGGGAGG + Exonic
924410815 1:243803347-243803369 GGGGCAAGTGGGGGACAGGATGG + Intronic
924588608 1:245381729-245381751 GGGGCTGGTGGGAGGGAGAATGG - Intronic
924893068 1:248306217-248306239 GGGGCTGGTGGCGCAGAGATGGG + Intergenic
1062828757 10:590937-590959 GAACCTGGTGGGGGACAGACTGG - Intronic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1062849180 10:729757-729779 GGGGCTGCTGCAGGCCAGAGCGG + Intergenic
1062961948 10:1578924-1578946 GGGTCTGGGGTGGGACACAGAGG + Intronic
1063201191 10:3785989-3786011 GGAGGTGGAGGAGGACAGAGAGG - Intergenic
1063201200 10:3786017-3786039 AGGGATGGAGGGGGACAGAGAGG - Intergenic
1063374560 10:5546297-5546319 CCTCCTGGTGGGGGACAGAGGGG + Intergenic
1063487141 10:6430629-6430651 TGGGCTGGTGGGGCAGGGAGGGG - Intronic
1063624838 10:7679313-7679335 GGGGCAGGGAGGGGACAGAAAGG + Intergenic
1063631196 10:7735166-7735188 TGGGCTGGGGTGGGAGAGAGCGG - Intronic
1063903536 10:10760263-10760285 GGGACTGGGGTAGGACAGAGAGG - Intergenic
1064089004 10:12367596-12367618 GGGGGTGATGGGAGACAGTGAGG + Intronic
1065291887 10:24238684-24238706 GGGGCTGGTGGAGAACAGAGTGG + Intronic
1065512382 10:26492236-26492258 GGGGCTCTTGGGGGAAAGAGAGG + Intronic
1065661509 10:28008095-28008117 GGGGGTCGGGGAGGACAGAGTGG - Intergenic
1067047073 10:42990851-42990873 AGGGCTGGTGGGGCTCAGAGAGG - Intergenic
1067069094 10:43119512-43119534 GGGCCTGGGGGCGGAGAGAGGGG - Exonic
1067088780 10:43256157-43256179 GTGGCTTGTGGGGCACAGTGTGG - Intronic
1067099245 10:43322800-43322822 GGGGCAGGTGAGGGGCGGAGGGG - Intergenic
1067772760 10:49139089-49139111 GGGGTTGGTGGTGTTCAGAGTGG + Intergenic
1068245928 10:54367646-54367668 GGGCCTGTTGGGGGAGTGAGGGG + Intronic
1069037029 10:63656261-63656283 GGGGATGGTGGGGGTGAGTGGGG + Intergenic
1069580146 10:69560147-69560169 GGGGCTGGGGGTGGACTGGGGGG + Intergenic
1069580181 10:69560298-69560320 GGGGCTGGTAGGGACAAGAGGGG + Intergenic
1069957547 10:72061248-72061270 GGGGATGTTGGGGAACAGCGAGG + Exonic
1070367416 10:75750482-75750504 GCGGGGGGTGGGGGGCAGAGGGG + Intronic
1071261862 10:83927370-83927392 ATGGCAGGTGGGGGACAGATGGG - Intergenic
1071856353 10:89628518-89628540 GGGGATTGTGGGGGAAAAAGAGG + Intronic
1071997227 10:91161159-91161181 GAGGCTGGAGGGGCAAAGAGAGG - Intergenic
1072019169 10:91381553-91381575 GGGGCTGGTGGGGGGTGGTGGGG - Intergenic
1072242393 10:93508767-93508789 GGGGTTGGGGGAGGACAGAATGG + Intronic
1072721210 10:97782071-97782093 AGGGCTGGTGGGGGGCCCAGTGG + Intergenic
1072948972 10:99835875-99835897 GGGGTTGGTGGGGAACAGAGTGG - Intronic
1073047577 10:100649664-100649686 GGGGGGGGTTAGGGACAGAGTGG + Intergenic
1073096992 10:100985903-100985925 GGGGATGGTGGGGAAATGAGAGG - Intronic
1073218029 10:101847456-101847478 TGGGCTGGAGGGGGAGCGAGGGG - Exonic
1073290739 10:102412049-102412071 ACGGCTTGTGGGGGACAGAGGGG + Intronic
1073711257 10:106045332-106045354 GGGGGTGGGGGTGGGCAGAGTGG + Intergenic
1074101562 10:110358254-110358276 GGGGCTGGAGAGGGGCACAGGGG - Intergenic
1074386530 10:113020765-113020787 GGGGTGTGAGGGGGACAGAGGGG + Intronic
1074542295 10:114374847-114374869 GGGGGTGGGGGTGGGCAGAGAGG + Intronic
1074815527 10:117138903-117138925 GTGGGGGATGGGGGACAGAGCGG + Intergenic
1074853009 10:117453965-117453987 GAGGCAGGTGGAGGAAAGAGTGG - Intergenic
1075446931 10:122519589-122519611 GAGGCTGGGGAGGGACAGAGTGG + Intergenic
1075528206 10:123203417-123203439 GGGGGTCCTGAGGGACAGAGGGG + Intergenic
1075716397 10:124558280-124558302 GTGGCTGGCTGGGGACAGGGAGG - Intronic
1075725391 10:124608269-124608291 CAGGCTGGTGGGGGGCAGACAGG - Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076164148 10:128268487-128268509 GAAGCAGGTGGGGCACAGAGCGG + Intergenic
1076171319 10:128322518-128322540 AGGGCTGGTTGGAGGCAGAGTGG - Intergenic
1076212023 10:128656679-128656701 TGGGCTGGCAGGGGACACAGAGG + Intergenic
1076307295 10:129474273-129474295 GGGGCTGGCAGGGGACTGATTGG + Intronic
1076314625 10:129531771-129531793 GGGGCTGGTGGGGGTGGGGGGGG + Intronic
1076468813 10:130704343-130704365 TGCTCTGGTGGGGGAAAGAGTGG - Intergenic
1076763177 10:132615815-132615837 GGAGCTGGTTGGAGACTGAGGGG + Intronic
1076788166 10:132761558-132761580 ATGGCTGGTGGGGGACAGCACGG + Intronic
1076806792 10:132862796-132862818 GAGGCTGGAGGGGGACGGGGCGG + Intronic
1076821639 10:132942670-132942692 GGAGCTGGCGGGGGGCAGGGCGG - Intronic
1076829208 10:132985818-132985840 GGGGCTGCTGGGGGTCGGGGAGG + Intergenic
1076830590 10:132992391-132992413 GGTGCTGGTGGGATGCAGAGGGG + Intergenic
1076948522 10:133666824-133666846 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076951480 10:133676732-133676754 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076952470 10:133680042-133680064 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076955426 10:133743003-133743025 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076956416 10:133746313-133746335 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076957404 10:133749622-133749644 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076959377 10:133756231-133756253 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1077038064 11:504664-504686 AAGGCTGGTTGGGGCCAGAGTGG - Intronic
1077172968 11:1176552-1176574 CGGGCTGGTGGCGGACGGCGAGG + Intronic
1077190265 11:1253058-1253080 GGGCATGGTGGGGCACAGTGGGG + Intronic
1077285527 11:1763688-1763710 GGGGCTCGTGGGGGCCACAGGGG + Intronic
1077287182 11:1772891-1772913 GGGGCTGGTGGGGGGAAAGGTGG + Intergenic
1077307327 11:1874129-1874151 GGGGCAGGCCGGGGACAGTGGGG + Intronic
1077307350 11:1874190-1874212 GGGGCAGGCTGGGGACAGTGGGG + Intronic
1077307372 11:1874251-1874273 GGGGCAGGCTGGGGACAGTGGGG + Intronic
1077307405 11:1874331-1874353 GGGGCAGGCTGGGGACAGTGGGG + Intronic
1077308941 11:1880068-1880090 GGGCCTAGTGGGGGACACAGAGG - Exonic
1077349490 11:2085857-2085879 GTGGCTGCTGGGTGACAGAAGGG + Intergenic
1077358813 11:2130771-2130793 GGGGTGGGTGGGGGGCAGTGGGG - Intronic
1077368737 11:2171867-2171889 GGGGAAGGTGGGGGACCCAGAGG - Intronic
1077384002 11:2260511-2260533 CTGGCTGGTGGGGGGCAGAGCGG - Intergenic
1077412065 11:2408226-2408248 ATGGAAGGTGGGGGACAGAGGGG + Intronic
1077553961 11:3217229-3217251 GGGGATGGGAGGGGACCGAGGGG + Intergenic
1078514158 11:12008704-12008726 CGGGCGGGTGCGGGAAAGAGGGG - Intronic
1078526414 11:12104896-12104918 TGGGGTGCTGGGGGACAGCGAGG - Intronic
1079007337 11:16801196-16801218 AGGCCTGGTGGGAGAGAGAGAGG + Intronic
1079363825 11:19792026-19792048 GGGCATGGTGGGGGAGAGAAGGG + Intronic
1080206529 11:29735849-29735871 TGGGTGGGTGGGGGACAGATGGG + Intergenic
1080336969 11:31208728-31208750 GGCCCTGGTGTAGGACAGAGTGG - Intronic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080475374 11:32585083-32585105 GGGGCGGGGGGAGGAGAGAGGGG - Intronic
1080571776 11:33563470-33563492 GGGGATGGGAGAGGACAGAGGGG - Intronic
1080656576 11:34263181-34263203 GGGGTTGGGGGGACACAGAGAGG + Intronic
1080864615 11:36182359-36182381 GGGGCAGGTGGAGGGGAGAGTGG - Intronic
1081656137 11:44858720-44858742 TGTGATGGTGGGGTACAGAGAGG + Intronic
1081705251 11:45179125-45179147 GGGGCTTGTGGAGGGCAGAGGGG + Intronic
1081733881 11:45390537-45390559 GGGGCTGGCTGAGGACAGGGAGG - Intergenic
1082184539 11:49163494-49163516 GGTGGTGGTGGGGGGCAGGGAGG - Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1082844795 11:57716907-57716929 GGGGTTGGTGCCGGGCAGAGGGG + Intronic
1083221997 11:61258713-61258735 GGGGCTGCTGGGGGCCAGGGTGG + Exonic
1083227319 11:61293501-61293523 AGGCCTGGAGGGGGACAGAGAGG + Intronic
1083544489 11:63538368-63538390 GGGGGTTGTGGGGGTCACAGAGG + Intronic
1083712968 11:64560069-64560091 GAGGCTGCTGGGGGAGTGAGGGG - Intronic
1083719513 11:64597510-64597532 GGGGATGGTGAGGGAGAGAGAGG - Intronic
1083897777 11:65628761-65628783 GGGGGTGGTGGGGGGCTGGGAGG + Intronic
1083922535 11:65788345-65788367 GGGGGTGGGGGAGGACAGAAGGG - Intronic
1084004982 11:66317833-66317855 GGGGGTGTTGGGGGAGTGAGGGG + Intergenic
1084164113 11:67367108-67367130 GGGGTTGGGTGGGGACAGAGGGG - Intronic
1084190191 11:67495197-67495219 AGCGCTGGTGGGGGACCAAGCGG - Exonic
1084456136 11:69269155-69269177 GGGGCCGGCAGGGGAGAGAGAGG + Intergenic
1084553709 11:69863872-69863894 GGGTGGGGTGGGGCACAGAGAGG + Intergenic
1084584335 11:70048573-70048595 GAGGGAGGTGGGGGAGAGAGAGG - Intergenic
1084715404 11:70870348-70870370 GGGGCTGGTTCTGGACAGATGGG + Intronic
1084715658 11:70871755-70871777 GGGGCTGGGAGGGGACAGCCAGG + Intronic
1084954195 11:72682921-72682943 GGGGAGGCTGGGGGGCAGAGGGG - Intergenic
1085409381 11:76282299-76282321 GGGGCATGTGGGGGACAGTGAGG + Intergenic
1085410517 11:76287891-76287913 GGGGTTGGTGTGGAACAGGGTGG + Intergenic
1085826937 11:79857945-79857967 GGGGCTGGTGGCAGCTAGAGGGG + Intergenic
1086400650 11:86458737-86458759 GGTGGTGGTGGGTGAGAGAGAGG + Intronic
1086666054 11:89483594-89483616 GGTGCTGGTGGGGGTGGGAGGGG + Intronic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1086789210 11:91014576-91014598 GGGGCTGTAGGTGGAGAGAGAGG + Intergenic
1086901839 11:92376240-92376262 GGGGGTGGATGGGGAAAGAGAGG + Intronic
1088348396 11:108856845-108856867 GGGGGTGGTGGGGGGTGGAGAGG - Intronic
1088917002 11:114235042-114235064 GGGGCTGGGGGTGGAGGGAGGGG + Intronic
1089263410 11:117239148-117239170 GGGGGTGGTGGGGTTCAGGGTGG + Intronic
1089324472 11:117647868-117647890 GGGGTTGGTGGGGCACAAAGGGG - Intronic
1089366543 11:117924364-117924386 GAGGCTGGTAAGGGACAGAGAGG - Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089631533 11:119787456-119787478 GTGGCTGGTGGGGGCTAGGGAGG - Intergenic
1089848122 11:121474328-121474350 GGGGCAGGTAGGGGGCGGAGAGG + Intronic
1090185736 11:124738211-124738233 GGGGAAATTGGGGGACAGAGTGG - Intergenic
1090393797 11:126406250-126406272 GGGGCTGTGGAGGGACAGACAGG + Intronic
1090873332 11:130767210-130767232 GGGGGTGGTGGGAGAGGGAGAGG + Intergenic
1090954753 11:131504166-131504188 GTGGCTGGTGGGGCTCAAAGGGG - Intronic
1090961979 11:131565220-131565242 GAGGCTGGAGGTGGACAGAGAGG - Intronic
1090998215 11:131886051-131886073 AGGGCTGGTGGGGAAGAGAGGGG - Intronic
1091138021 11:133210372-133210394 GGGGCTGGCGGGAGAAAGAGGGG - Intronic
1091248240 11:134118570-134118592 GGGGTTGGTGGGAGACAGGCAGG - Intronic
1091387753 12:105367-105389 GGCTCTGGGGTGGGACAGAGTGG + Intronic
1091882583 12:3991359-3991381 CGGGCGGGTGGGGGGCCGAGAGG + Intergenic
1092123791 12:6062260-6062282 ACGGTTGGTGGGGGTCAGAGTGG + Intronic
1092163853 12:6330549-6330571 GGAGCTGGTGGGGGTGAGGGAGG - Intronic
1092257738 12:6936518-6936540 GGGGCTGATTGGAGACAGAGAGG - Exonic
1092526792 12:9314491-9314513 GGGGCTGGTGAGGGGCCGGGAGG - Intergenic
1092540479 12:9417288-9417310 GGGGCTGGTGAGGGGCCGGGAGG + Intergenic
1092843218 12:12562471-12562493 GGGGGTTGGGGGGGAGAGAGAGG + Intergenic
1093300100 12:17443074-17443096 GGGTGGGGTGGGGGACATAGGGG + Intergenic
1093847735 12:23994638-23994660 GAGCATGGTGGGGGCCAGAGTGG + Intergenic
1094430226 12:30360303-30360325 GGGGCGGGGGGCGGACACAGGGG + Intergenic
1094512565 12:31105191-31105213 GGGGCTGGTGAGGGGCCGGGAGG - Intergenic
1096156439 12:49343922-49343944 TAGGCTGGTGGTGGCCAGAGAGG + Intergenic
1096184134 12:49567407-49567429 GGGGTTGTTGGGGCACAGCGTGG - Intronic
1096224104 12:49853858-49853880 GGGGTTAGTGGGTGGCAGAGGGG + Intergenic
1096233523 12:49910616-49910638 GGGGCTGCTGGGGATGAGAGAGG - Intergenic
1096520743 12:52183273-52183295 GGAGCTGGTGGCTGACAGACTGG - Intronic
1096618178 12:52846409-52846431 GGGGCTGGAGGAGGAAGGAGGGG - Intronic
1096630082 12:52920966-52920988 GGGGCAGGTTGGTTACAGAGTGG - Intronic
1096681261 12:53256861-53256883 GGGGCTGGTGGCAAATAGAGTGG + Intergenic
1096689328 12:53309718-53309740 GGGTCTGGAGGGGAACACAGAGG + Exonic
1096797153 12:54085111-54085133 GAGGCTGGTGGGGGAAAGAGAGG - Intergenic
1097173112 12:57128451-57128473 GGGGCTGATGGGGGAGAGGGAGG - Intronic
1097186791 12:57200415-57200437 AGGGCAGGTGGGGGCAAGAGGGG - Intronic
1097263737 12:57734288-57734310 GGAGGTGGTGGGGGACAGGCTGG - Intronic
1097264775 12:57738581-57738603 GGGGCAAATGGGGGAGAGAGAGG + Intronic
1097823093 12:64147344-64147366 GGTGGGGGTGGGGCACAGAGCGG - Exonic
1097823109 12:64147411-64147433 GGGGAAGGTGGGGGACAGGGAGG - Exonic
1098033441 12:66278361-66278383 AGGGCAGGTGGGGAAGAGAGAGG + Intergenic
1098157028 12:67609640-67609662 GGTGCTGGTGGGGGGTAGGGGGG - Intergenic
1099140491 12:78968370-78968392 GAGGGTGGTGGGGGCTAGAGGGG - Intronic
1099259525 12:80360426-80360448 GGGGGGGGAGGGGGAGAGAGGGG - Intronic
1099797077 12:87412580-87412602 GGGCCTGGTGGTGGGCACAGTGG - Intergenic
1101223918 12:102668546-102668568 GGGGGTGTTGGGGGAGAGAGAGG - Intergenic
1101728295 12:107405859-107405881 GGAGCTGGTGAGGAGCAGAGTGG - Intronic
1101737365 12:107473054-107473076 GGGGCTGAGTGAGGACAGAGAGG + Intronic
1101784161 12:107867499-107867521 GGGGCAGGTAGGGGAGAGAAGGG - Intergenic
1102182689 12:110924093-110924115 GGGGCTGGGGAGGGAGCGAGTGG + Intergenic
1102394250 12:112574209-112574231 GGGGGTGGTGGAGGAGTGAGGGG + Intronic
1102394289 12:112574338-112574360 GGGGGTGGTGGAGGAGGGAGAGG + Intronic
1102394347 12:112574521-112574543 GGGGATGGTGGAGGAGGGAGAGG + Intronic
1102394398 12:112574676-112574698 GGGGGTGGTGGAGGAGGGAGGGG + Intronic
1102394441 12:112574811-112574833 GGGGGTGGTGGAGGAGGGAGAGG + Intronic
1102656289 12:114484938-114484960 GGGGCGGCTGCAGGACAGAGGGG + Intergenic
1103253876 12:119523605-119523627 GGGGCTAAGGGGGGCCAGAGTGG + Intronic
1103517870 12:121519000-121519022 GGGGATGGTGGGCCACAGAGAGG + Intronic
1104035000 12:125092001-125092023 GGGGTGGTTTGGGGACAGAGAGG - Intronic
1104102312 12:125624280-125624302 AGTGCTGGTGAGGGGCAGAGAGG + Intronic
1104360549 12:128129127-128129149 GGGGCGGGCGGGGGACAGAAGGG - Intergenic
1104640836 12:130465872-130465894 GGTGCTGGGTGGGGGCAGAGGGG - Intronic
1104697164 12:130872212-130872234 GGGGCGGGTGGCGGACCCAGGGG + Intronic
1104785301 12:131444807-131444829 GGGGATGGGGGGGGAAGGAGCGG - Intergenic
1104887634 12:132119994-132120016 GGGCCTGGTGGGGGATGGGGCGG - Intronic
1104958926 12:132479013-132479035 GAGGCTGGAGTGGGCCAGAGTGG + Intergenic
1104958950 12:132479103-132479125 GAGGCTGGAGTGGGCCAGAGTGG + Intergenic
1104968517 12:132520687-132520709 TGGGCAGGTTCGGGACAGAGGGG + Intronic
1105612576 13:21982153-21982175 GGGGCTGGTGGAGGCAAGAGAGG - Intergenic
1106180165 13:27363073-27363095 GGGGTTGGTGGGGGATGGCGGGG - Intergenic
1106249153 13:27970994-27971016 GGGGGTGGTGGGGTACTCAGGGG + Exonic
1107412802 13:40172997-40173019 AGGGGATGTGGGGGACAGAGAGG - Intergenic
1107468084 13:40666789-40666811 TGGGCTGGTGGGGGGTAGTGGGG + Intergenic
1107675841 13:42795854-42795876 GGGGCTGGTTGGGGGCTGGGAGG + Intergenic
1107872216 13:44757857-44757879 GGGGAAGATGGGGAACAGAGTGG - Intergenic
1107872472 13:44759980-44760002 GGATTTGGTGGGGGGCAGAGGGG + Intergenic
1107907296 13:45072878-45072900 AGGGTTGGTTGGAGACAGAGGGG + Intergenic
1108201157 13:48044773-48044795 GGGGCGGGAGGGGGAGAGGGAGG - Intronic
1108347397 13:49559687-49559709 GGGGCTGGGGGAGGACAGAATGG + Intronic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1108574090 13:51776850-51776872 GGGGTTGGGGGGGTTCAGAGAGG + Intronic
1108709477 13:53018326-53018348 TGAGCTGGTGGGGGTCAGAAGGG - Intergenic
1108777146 13:53780583-53780605 GGGGTTGGTGGGGGACAGTCAGG - Intergenic
1108798740 13:54067078-54067100 GGGGCAGGTGGGGGTCAGGGTGG - Intergenic
1109769003 13:66945261-66945283 GGGGCTGCTGGGGGAGTGTGAGG - Intronic
1109771486 13:66980244-66980266 GGGGGTGGTGTGGGAGATAGAGG - Intronic
1110707249 13:78609455-78609477 GGGTCCGGTGGGGGCTAGAGGGG + Intergenic
1111091325 13:83452024-83452046 GAGGCTGGTGAGGGGCAGAGTGG - Intergenic
1112001118 13:95210920-95210942 GGTGCTGGTGGGGCAGAGAGAGG - Intronic
1112573365 13:100613821-100613843 GGGGCGGGTAGGGGGGAGAGGGG - Intronic
1112871664 13:103978463-103978485 GGGGTTGGTGGGGGAGGAAGGGG + Intergenic
1113665229 13:112136613-112136635 GGGGTTGGGGGAGGACAGAGAGG - Intergenic
1113805941 13:113110079-113110101 AGGGGTCGCGGGGGACAGAGGGG + Intronic
1113938715 13:114007769-114007791 GGGGCTGGGGTGGCACAGTGGGG - Intronic
1114416120 14:22545862-22545884 GGGGCTGGTGGGTGTCAGACTGG - Intergenic
1115379764 14:32722648-32722670 TCGGCTGGCTGGGGACAGAGAGG + Intronic
1115680290 14:35730544-35730566 GGGCATGGTGGGAGACAGACTGG + Intronic
1115973770 14:38974432-38974454 GAGGGTAGTGGGGGACTGAGGGG - Intergenic
1116673767 14:47878409-47878431 GGGGGTGGAGGGTGACAGAAAGG + Intergenic
1116930085 14:50682175-50682197 GAGGGTGGTGGGGGTCTGAGGGG - Intergenic
1117042135 14:51777013-51777035 GGGCCTGGTGGGGCAGAGAAAGG - Intergenic
1117176075 14:53148139-53148161 GAAGGTGGTGGGTGACAGAGGGG + Intronic
1117336744 14:54762496-54762518 GGGGTGGGTGGGGGAGAGCGAGG - Intronic
1117391404 14:55266330-55266352 GGGGGTGGTGGGGGCGGGAGGGG - Intergenic
1117764037 14:59061358-59061380 GAGGCTGTGGGGAGACAGAGTGG - Intergenic
1118638968 14:67774524-67774546 GGGGATGGTAGCGGACAGTGCGG + Intronic
1119034287 14:71216499-71216521 GGGGCGGGTGGGGAAGAAAGTGG - Intergenic
1119480872 14:74956824-74956846 GGGGCTGGTGGGTGGCTGTGGGG + Intergenic
1119719641 14:76882497-76882519 GGGCCTGGTGAGGGGCAAAGTGG - Intergenic
1119741293 14:77015280-77015302 GTGGCTGGTGGGAGAGGGAGGGG + Intergenic
1119999452 14:79285858-79285880 GGGGATGGTGGGGGGCGGTGGGG - Intronic
1120800102 14:88678276-88678298 GGGCCTCTTGGGGGACAGGGAGG + Intronic
1121105080 14:91274208-91274230 GGAGGGGGTGGGGGACAGAGAGG + Intronic
1121641436 14:95487066-95487088 GGGGCGGGTGGGGCAGAGTGGGG - Intergenic
1121839238 14:97118834-97118856 TGGGCTGGGTGGGTACAGAGAGG + Intergenic
1122093985 14:99357837-99357859 GGGGGGGGTGGGGGACAAGGCGG + Intergenic
1122163805 14:99805965-99805987 GGAGCTGGCGGGGGAGAGTGGGG - Intronic
1122272731 14:100575634-100575656 GGGGCTGGTGGGGGAAGGTGGGG + Intronic
1122295069 14:100700862-100700884 GGAGCTGGTGAGGCACACAGAGG + Intergenic
1122311868 14:100802559-100802581 GGGGTTGCTGGGGAACAGTGTGG + Intergenic
1122707057 14:103628435-103628457 GTGGCTGCGTGGGGACAGAGGGG + Intronic
1122794109 14:104197136-104197158 GGGGATGGTGAGGCCCAGAGAGG - Intergenic
1122862403 14:104588496-104588518 GGGGCTGGTGGGGAAGGGATGGG - Intronic
1122885159 14:104707579-104707601 GGGGGTGGTGGGGGAGGGGGAGG - Exonic
1122889545 14:104725984-104726006 GGGGCTGTGGGGGGACTGGGTGG - Intronic
1122954711 14:105065285-105065307 GGAGCTGGAGGCGGGCAGAGGGG - Intronic
1123042747 14:105497039-105497061 GGGGCTGGTGTGGGGGACAGCGG + Intronic
1123886986 15:24735945-24735967 GAGGGTGGAGAGGGACAGAGAGG + Intergenic
1124023515 15:25944579-25944601 GGGGCTGGCGGAGGCCCGAGTGG - Intergenic
1124370508 15:29102302-29102324 TAGCCTGGAGGGGGACAGAGGGG + Intronic
1124495822 15:30186285-30186307 GGGGCTGGGGGGGGAAGGAGGGG - Intergenic
1124601498 15:31136297-31136319 GGGGCTGGTGTGGGAGAGACAGG - Intronic
1124640185 15:31392097-31392119 GGGGCTGGCCGGGGTCCGAGGGG - Intronic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1125692015 15:41603484-41603506 AGAGTTGGTGGGGGACAGTGGGG + Intergenic
1126924717 15:53571141-53571163 ATGGGTGGTGGGGGAAAGAGGGG + Intronic
1127169874 15:56290204-56290226 GTGTCTGTTGGGGGGCAGAGGGG + Intronic
1127342971 15:58066092-58066114 GGGGCTGGCGGGGACCGGAGCGG + Exonic
1127531203 15:59845324-59845346 GGTGTTGGACGGGGACAGAGAGG - Intergenic
1127834181 15:62776862-62776884 GGGGCTGGTTGGGGGCATGGTGG + Exonic
1128155050 15:65386653-65386675 GAGTCTGGTGGGGGAGAGAGAGG + Exonic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128224689 15:65993647-65993669 GGGGCGGGTAGGGGAGGGAGAGG + Intronic
1128304061 15:66586604-66586626 GGGGCTGGTGGGGATCACATCGG + Intronic
1128522653 15:68385986-68386008 TGGGCTGGGGAGGGACAGAATGG - Intronic
1128534766 15:68482081-68482103 GAGGCTGGTGGGGGACCGGGGGG + Intergenic
1128752855 15:70161393-70161415 GAGGCAGGTGGGGGGCGGAGAGG + Intergenic
1129162332 15:73753470-73753492 GGGGCTGGAGGCGGACTGACCGG + Intergenic
1129501784 15:76045793-76045815 GGGGCTGGTTGGGGGAAGTGGGG + Intronic
1129642327 15:77393324-77393346 TGGGGTTGTGGGGGACAGTGTGG - Intronic
1129739354 15:77982583-77982605 GGGGCGGGGGGGAGACTGAGAGG - Intergenic
1130151633 15:81315791-81315813 GGGGTTGGTGGGTGAGGGAGAGG + Intronic
1130167117 15:81472801-81472823 AGGGTTGGTGGGGGCCAGGGAGG + Intergenic
1130270401 15:82443299-82443321 GGGGAGGGTGGGGCACAGGGTGG - Intergenic
1130275567 15:82474532-82474554 GGGGAGGGTGGGGCACAGGGTGG + Intergenic
1130462746 15:84170618-84170640 GGGGAGGGTGGGGCACAGGGTGG - Intergenic
1130467926 15:84201924-84201946 GGGGAGGGTGGGGCACAGGGTGG + Intergenic
1130485760 15:84397583-84397605 GGGGAGGGTGGGGCACAGGGTGG - Intergenic
1130489931 15:84424169-84424191 GGGGAGGGTGGGGCACAGGGTGG + Intergenic
1130496340 15:84471618-84471640 GGGGAGGGTGGGGCACAGGGTGG - Intergenic
1130501519 15:84502919-84502941 GGGGAGGGTGGGGCACAGGGTGG + Intergenic
1130555959 15:84922694-84922716 GGGGCAGGTGGGCCACAGAGGGG - Intronic
1130590218 15:85206522-85206544 GGGGAGGGTGGGGCACAGGGTGG + Intergenic
1130658786 15:85813498-85813520 GGGGTTTGTGGTGGAAAGAGTGG - Intergenic
1130946267 15:88552607-88552629 GGGGCGGCTGGCGGGCAGAGGGG + Intergenic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1131145618 15:90009690-90009712 GGGGTTGGGGAGGGAGAGAGAGG - Intronic
1131443290 15:92474977-92474999 GGGGGTGGTGGAGGAATGAGTGG - Intronic
1131468748 15:92676751-92676773 GGGGAGGGTGGGAGAGAGAGAGG - Intronic
1131625797 15:94119344-94119366 TGGGCTGGAGGGGGTCAGAAGGG - Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1131988093 15:98065384-98065406 GGAGCTTGTGGGGTCCAGAGTGG - Intergenic
1132462997 16:64637-64659 GGGGCTGGTGGGGCAGAGGCAGG - Intronic
1132553794 16:564151-564173 GGGGCTCCTGGGGGAGACAGGGG - Exonic
1132563415 16:609330-609352 GGGGATGGTGGGGGACAGGGTGG + Intronic
1132591243 16:727274-727296 GGGGCTGGTTGGGGACCGGCCGG + Exonic
1132638466 16:965771-965793 GGGGCTGGAGGTGGGTAGAGGGG + Intronic
1132802029 16:1759222-1759244 GGCGCTTGTGGGGTTCAGAGAGG - Intronic
1132925736 16:2428439-2428461 CTGTCTGGTGGAGGACAGAGGGG - Intergenic
1133026295 16:2990309-2990331 AGGGCTCGTGGGAGAGAGAGAGG - Intergenic
1133027664 16:2995700-2995722 GGGGCTGGTGAGTGACTCAGGGG - Intergenic
1133102320 16:3486848-3486870 GGGGCAGGTGTGGGGCAGGGTGG - Exonic
1133209836 16:4257460-4257482 GGGGCTGGGGGGTGGGAGAGTGG + Exonic
1133328324 16:4956004-4956026 GGGGCTGGAGGAGGAGGGAGTGG + Intronic
1133801821 16:9091306-9091328 GGGGCGGGTGGGGGGTGGAGGGG - Intergenic
1134044229 16:11089575-11089597 GGGGCCAGTGTGGGACAGAGGGG - Intronic
1134098653 16:11436224-11436246 GGGGCTGGTGGGGGAAGCAGAGG + Intronic
1134308457 16:13054752-13054774 GGGGCTGGAGGTGCAGAGAGAGG - Intronic
1134382828 16:13744225-13744247 GTGGATTGTTGGGGACAGAGTGG - Intergenic
1134521321 16:14920360-14920382 GGGGCTCGTGCGGGGCTGAGAGG - Intronic
1135403307 16:22181059-22181081 GGGGCTGAGGGTGGACAGAGGGG + Intronic
1135985663 16:27181951-27181973 GAAGCAGGTAGGGGACAGAGAGG - Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136180680 16:28549736-28549758 GGGTATGGTGGGGGACAGGGAGG - Intergenic
1136236912 16:28919940-28919962 GAGTCTGGTGGGGGAGAGGGAGG + Exonic
1136246492 16:28979181-28979203 GGGCCTGGTGGGGGTCGGGGAGG + Exonic
1136273021 16:29159413-29159435 GGGGTTGGTGGGGGTCGGGGGGG + Intergenic
1136354595 16:29735928-29735950 GGTGCTGATGGGGGGCAGAAAGG + Intergenic
1136356156 16:29745854-29745876 GGAGGATGTGGGGGACAGAGAGG - Intronic
1136403523 16:30030808-30030830 TGGCTTGGTGAGGGACAGAGAGG + Exonic
1136461107 16:30410644-30410666 AAGGCAGTTGGGGGACAGAGGGG + Intronic
1136518917 16:30784099-30784121 GGGGGTTCTGGGGGACAGAGGGG + Exonic
1136541164 16:30928253-30928275 GGGGCTGGAGAGGGCCTGAGGGG + Intronic
1136542424 16:30935589-30935611 GGGTCTGGAGGTGGACAGATTGG + Intronic
1137022265 16:35440475-35440497 GTGGCTGCTGTAGGACAGAGAGG - Intergenic
1137028774 16:35502939-35502961 GGAACTTGTGGGGGAGAGAGAGG - Intergenic
1137389115 16:48066931-48066953 GGGGCTGGCGGGTGCCAAAGTGG - Intergenic
1137530279 16:49275119-49275141 GGTGGTGGTGGGGGATAGTGCGG - Intergenic
1137564862 16:49526597-49526619 CGGGCTGCAGGAGGACAGAGGGG + Intronic
1137578752 16:49621014-49621036 GGGGCTGCTGAAGGAGAGAGAGG - Intronic
1137688337 16:50402383-50402405 GAGGCTGGCAGGGGCCAGAGAGG - Intergenic
1137719789 16:50621352-50621374 TAGGCTGGTGGGGGCCTGAGGGG + Intronic
1138177587 16:54915262-54915284 GGGGGTGGTGGGGGGCGAAGGGG + Intergenic
1138453223 16:57106096-57106118 GGGGCAGGCGGGGGGAAGAGTGG - Intronic
1138489993 16:57371244-57371266 GGGGGTGGTTGAGGAGAGAGAGG + Intergenic
1138741189 16:59312735-59312757 GGGGGTGGTGGGGAAAAGGGAGG - Intergenic
1139136073 16:64206211-64206233 GGGAGTGGTGGGGGGCGGAGTGG + Intergenic
1139355571 16:66365396-66365418 CAGGCTGGTGGGGGAGACAGGGG - Intergenic
1139390451 16:66604270-66604292 GGGGCTGGCCGGGGACAGGAGGG + Exonic
1139510258 16:67424134-67424156 GGGGCTGGTGGGGGAGAGGCGGG - Intergenic
1139580778 16:67872611-67872633 GGGGATGCTGGGGGACAGTAGGG + Intergenic
1139614686 16:68081794-68081816 GGGGGTGGAGGGGGACAGTCAGG + Intergenic
1139656216 16:68388600-68388622 GCAGCTGGTGGGGGACAGTTTGG - Intronic
1139797845 16:69497623-69497645 GGGGCTGGTGGGAGGAGGAGGGG - Intergenic
1140063653 16:71592019-71592041 GGGGGGGGGGGGGGAAAGAGTGG - Intergenic
1140175956 16:72659996-72660018 GGTGTCGGTGGGGGAAAGAGAGG - Intergenic
1141132461 16:81445203-81445225 GGGGCTGGGGGCGGGGAGAGGGG - Exonic
1141449150 16:84085553-84085575 GGGGCGGGTGCGGGGCTGAGGGG - Intronic
1141601191 16:85127255-85127277 GGGGTTGGTGGGGTAGGGAGCGG + Intergenic
1141663101 16:85452362-85452384 GGGAGAGGTGGGGGCCAGAGTGG - Intergenic
1141813606 16:86393600-86393622 GGGGCTGCTGAGGGATAGGGGGG + Intergenic
1141834746 16:86531402-86531424 GGGGCTGGGGAGGGGAAGAGGGG + Exonic
1142052370 16:87967064-87967086 GGGGCTGCTGTGGGACAGGCTGG + Intronic
1142070876 16:88090806-88090828 GGGGGTGGTGGGGGTGAGGGTGG + Intronic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142157811 16:88540587-88540609 GGGGCTCTGAGGGGACAGAGGGG - Intergenic
1142261215 16:89043310-89043332 GAGGGTGGTGGCAGACAGAGAGG - Intergenic
1142282317 16:89154970-89154992 GGGGCAGGTGGGGGTCTGGGTGG - Exonic
1142286795 16:89174777-89174799 GGCTTGGGTGGGGGACAGAGAGG + Intronic
1142300496 16:89255050-89255072 GGGGCTGGAGGTGAACAGCGAGG + Intergenic
1142356235 16:89603493-89603515 GGGGCTGGAGGGGGGCACTGGGG + Intergenic
1142356546 16:89604262-89604284 GGGGCTGGAGGGGGTCACTGGGG + Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142495649 17:305069-305091 AGGGCGGGAGGGGGACAGGGCGG + Intronic
1142579014 17:929232-929254 CCAGGTGGTGGGGGACAGAGTGG - Intronic
1142669204 17:1479722-1479744 GGGGCAGGAGGGGGTGAGAGGGG + Intronic
1142739234 17:1921096-1921118 GGGGGTGGTGGGGGAAAGGATGG - Intergenic
1142809055 17:2386826-2386848 GGAGCTGGTGGGTGAGAGAGTGG + Exonic
1142858284 17:2745572-2745594 GGGGAGGGTGGGAGATAGAGTGG + Intergenic
1143175176 17:4951059-4951081 GGGGCTGGCTGGGGACCGAGTGG + Intronic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1143500432 17:7335632-7335654 GGGGCTGGTTGGGGGCGGAGTGG + Intergenic
1143524551 17:7464470-7464492 GGGGCTGGAGGGAGGCAGACCGG + Intronic
1143713826 17:8753247-8753269 GAGGCTGGAGGAGGGCAGAGAGG - Intronic
1143767641 17:9148084-9148106 GGGGCTGGGTAGGGGCAGAGGGG + Intronic
1144058254 17:11559871-11559893 GAGCCTGGTGGGGGAAAGAAGGG + Exonic
1144339345 17:14299540-14299562 GTGGCTGGTCCTGGACAGAGTGG + Intergenic
1144581204 17:16460514-16460536 GGGGCAGGTTGGGGAGGGAGGGG + Intronic
1144624539 17:16838027-16838049 GGGGGTTGTGGGAGAAAGAGTGG + Intergenic
1144702028 17:17346412-17346434 CAGGATGGTGGGGCACAGAGAGG + Intronic
1144843588 17:18203951-18203973 GGGGCTTTTGGGGCACACAGGGG + Intronic
1144879034 17:18421495-18421517 GGGGCAGGAGAGGGGCAGAGAGG - Intergenic
1144922122 17:18772744-18772766 GGGGGTGGTGGGAGACGGGGAGG + Intronic
1145017893 17:19411028-19411050 GGAGGGGGAGGGGGACAGAGAGG - Intergenic
1145153203 17:20522899-20522921 GGGGCAGGAGAGGGGCAGAGAGG + Intergenic
1145207601 17:20992844-20992866 GGGCCTGGCGGGGGAGAGGGAGG - Intergenic
1145969964 17:28950885-28950907 GGGGCTGATGGAGGTAAGAGTGG - Exonic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146267053 17:31459764-31459786 GGGACTGGTGGGGGATAAAGAGG - Intronic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146750359 17:35373391-35373413 GGGGCTGGAGGGGTGCGGAGGGG - Intronic
1146943026 17:36857001-36857023 GGGGCTGTTGGGTATCAGAGTGG - Intergenic
1147190054 17:38733257-38733279 AGGGCTGGTGGGGGAAAGACAGG - Exonic
1147578670 17:41616748-41616770 GGGGGTTGTGGGAGAAAGAGTGG + Intergenic
1147738390 17:42655439-42655461 GGGACTGGTGCGGGGCAGGGAGG + Intergenic
1147773359 17:42883152-42883174 GGTGCTGGCGGGGGAGACAGTGG + Intergenic
1147811569 17:43173821-43173843 GGTGGGGGTGGGGGGCAGAGGGG - Intronic
1147967425 17:44200447-44200469 GAGGGTGGCGGGGGAGAGAGCGG - Intergenic
1148075917 17:44935168-44935190 TGAGCTGGTGTGGGACAGGGTGG - Intronic
1148334501 17:46832404-46832426 GGGGGTGGTGGAGGAGAGAAGGG + Intronic
1148355329 17:46971978-46972000 GGGGCTGGTGGGGTAGGCAGAGG + Intronic
1148457003 17:47816523-47816545 GGGGCTGGTGGGGAGCGGACAGG - Intronic
1148549327 17:48541395-48541417 GGGTGTGGTGGGGGATAGACAGG + Intronic
1148563423 17:48619406-48619428 GGGGGTGGCAGGGGGCAGAGAGG - Intronic
1148868133 17:50639698-50639720 GGGGCTGGCAGGGGGCAGGGTGG + Intronic
1149445126 17:56707547-56707569 GGGGATGGTGCGGGGCAGAGGGG + Intergenic
1149456852 17:56794986-56795008 GGGAGTGGTGGGGGACAGCATGG - Intronic
1149614657 17:57988036-57988058 GGGGCACGGGGGGGACAGGGGGG - Intronic
1149853047 17:60052840-60052862 GGGGCTGGTGAGGGGCGGCGGGG + Intronic
1149867648 17:60159584-60159606 GTGGGTGGAGGGGGACAGGGTGG - Intronic
1149993951 17:61397293-61397315 GGGGCTGGAGGGGGAGGGCGCGG - Intergenic
1150291885 17:63987136-63987158 GGGGCTGCTGGAGGAGAGAGGGG - Intergenic
1150294860 17:64002196-64002218 GTGGCTGGAGGGGCCCAGAGTGG + Exonic
1150343626 17:64387806-64387828 CGGGCTGGAGGGGAACAAAGAGG + Intronic
1150411036 17:64940759-64940781 AGGGCTGGTGAGGGACAGAGGGG + Intergenic
1150462426 17:65363914-65363936 CGGGGTGGTGGGGGAGAGGGAGG - Intergenic
1150584260 17:66503108-66503130 AGGGGTGGTGGGGGAGAGAGTGG + Intronic
1150988413 17:70226670-70226692 AGGCTTGGTGAGGGACAGAGAGG + Intergenic
1151504708 17:74520075-74520097 GGGGCTGGTGGAGGAGTGGGAGG + Intergenic
1151560456 17:74866873-74866895 GGTGCTGCTGGGGAACAGGGTGG + Exonic
1151771029 17:76161800-76161822 GGGACTGGTGGGTGGGAGAGGGG - Intronic
1151830208 17:76544979-76545001 GGGGCTGCTGGCGGCCAGCGGGG + Intronic
1151842280 17:76627010-76627032 GGGGCTGGAGGGGGCAGGAGAGG + Intronic
1152088149 17:78232456-78232478 GGGGCTGTGGGGCGACAGTGGGG + Intronic
1152197912 17:78928373-78928395 GGGGCTGGGAGGGGACACGGCGG + Intergenic
1152238115 17:79148912-79148934 GGGGATGGAGGGGGACAGCCTGG + Intronic
1152287899 17:79423076-79423098 GGGGCTGGAGGCAGAAAGAGGGG - Intronic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1152412222 17:80133118-80133140 GGGCATGGTGCGGGACAGGGTGG - Intergenic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152659361 17:81535309-81535331 GGGGCTGGTGGGGGTGGGGGTGG - Intronic
1152750250 17:82059262-82059284 TGGCCTGGTGGGGGGCAGTGTGG + Intronic
1152793304 17:82293392-82293414 GGGGAGGGTGGGGGAAGGAGGGG + Intergenic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1152855643 17:82663523-82663545 GGGGGTGCTGGGGGAGGGAGAGG + Intronic
1152861476 17:82698838-82698860 GGGGCGGGTGGGCGACAGCCCGG - Intergenic
1152886631 17:82855133-82855155 AGGGGTGGTGGGGGCCAAAGTGG - Intronic
1152928700 17:83099460-83099482 GGGCCTGGTGGGGGAAGGAATGG - Intergenic
1152961566 18:83315-83337 GGGGCCAGTGGGGGCCAGTGGGG - Intergenic
1153285197 18:3450097-3450119 GGGGCGGGAGGGGGACGGGGCGG + Intronic
1153290835 18:3499850-3499872 TGGGCGGGCCGGGGACAGAGCGG - Intronic
1153541408 18:6159693-6159715 AGGGCTGGTGGGGTATGGAGTGG - Intronic
1153862541 18:9227941-9227963 GGGATTGGTGGGGGAGAGTGGGG - Intronic
1153942008 18:9986605-9986627 GGAGCATGTGGGGGACAGGGAGG + Intergenic
1154170705 18:12048187-12048209 GGGACTGGTGGGGCACTGACTGG - Intergenic
1154289104 18:13090745-13090767 GGGGCTGTAGTGGGACAGATGGG - Intronic
1155872267 18:31042918-31042940 GTGGCTGCTGGGGAGCAGAGGGG - Intergenic
1156149519 18:34224955-34224977 GGGGAGGGTGGGGGAAGGAGAGG - Intergenic
1156317868 18:35987757-35987779 GGGGCTGGTGGGGAGGAGGGTGG + Intronic
1156466531 18:37351102-37351124 GGTGCTGGTGGGGGAGAGGGGGG + Intronic
1156467073 18:37354383-37354405 GGGACTGGTGGGGGGCGCAGAGG + Intronic
1156962557 18:43050627-43050649 GGGGCAGATGGAGGACAGAAGGG - Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157245068 18:46046473-46046495 AGGGCTGGGGTGGGACTGAGGGG - Intronic
1157248217 18:46071926-46071948 GTGGGTAGCGGGGGACAGAGAGG + Intronic
1157280386 18:46343201-46343223 GGGGCTGCTGGTGGGCAGAGAGG - Intronic
1159798231 18:72868215-72868237 GGGGCTGGTGCGCGGCAGAATGG + Intergenic
1160042804 18:75360842-75360864 GGGAGAGGTGGGGGACAGAGAGG + Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160499577 18:79395478-79395500 GGGGCTGGCGGGGGAAACGGGGG - Intergenic
1160705851 19:529903-529925 GGGGCACCTGCGGGACAGAGTGG + Intergenic
1160798067 19:954818-954840 GGGGCTGATGGGGGGCGGTGGGG + Intronic
1160817145 19:1041470-1041492 GGAGACGGTGGGGGACAGTGGGG - Intronic
1160844251 19:1159615-1159637 GGGGCAGTGGGGGGACAGCGGGG + Intronic
1160844308 19:1159771-1159793 GGGGGCAGTGGGGGACAGTGGGG + Intronic
1160918096 19:1507190-1507212 GGGGTCGGCTGGGGACAGAGGGG - Intronic
1161067896 19:2247570-2247592 TGGGAGGGCGGGGGACAGAGAGG - Intronic
1161137508 19:2628675-2628697 GGGGCTGGGGGAGGGAAGAGGGG - Intronic
1161209991 19:3061466-3061488 GGGGGTGGCGGGGGACGGGGCGG - Intronic
1161253947 19:3295872-3295894 GGGGGTGGTGAGGGGCAGGGGGG - Intronic
1161268308 19:3375358-3375380 GGGGGTGGTGGGGGGCACAGTGG - Intronic
1161295672 19:3519079-3519101 GGGGCCGTGGGGGCACAGAGAGG + Intronic
1161352845 19:3803466-3803488 GGGGCAGGCGGGGAGCAGAGTGG - Intergenic
1161382117 19:3970971-3970993 AGGGCTGGGTGGGGCCAGAGCGG - Exonic
1161422215 19:4182251-4182273 GGGGCTGATCGGGGAGAGAGGGG - Intronic
1161445827 19:4318607-4318629 GGGGCTGGTGGAACCCAGAGAGG + Intronic
1161589726 19:5123927-5123949 GGGACTGGCGTGGGACAGGGAGG + Intronic
1161649824 19:5477724-5477746 TGGGTTGGAGGGGGGCAGAGTGG - Intergenic
1161696678 19:5772671-5772693 GGGGGTGGGAGGTGACAGAGAGG - Intronic
1161703825 19:5808556-5808578 GGTGCCGGTGGGGGACTGCGGGG + Intergenic
1161878006 19:6926880-6926902 GGGGGTGGTGGGGGTGAAAGTGG + Intronic
1161945738 19:7435425-7435447 GGGTCAGTTGAGGGACAGAGGGG + Intronic
1161977219 19:7613278-7613300 TGGGCGGGTGGGGGATAGATGGG + Intronic
1162068751 19:8141425-8141447 GGGGCTGGAGCGGGAGAGAGTGG - Intronic
1162109052 19:8390459-8390481 GCGGCCGGTGGGGCACAGACGGG + Intronic
1162182083 19:8876717-8876739 GGGGGTGGTGTGGGACAGGGTGG + Intronic
1162188246 19:8923680-8923702 TTGGCTGGTGAGGGGCAGAGAGG - Intronic
1162299343 19:9835417-9835439 GGGGCTGGGGCGGGACTGCGCGG + Intronic
1162320702 19:9969541-9969563 GGGGCAGGGGTGGGACAGGGTGG - Intronic
1162330158 19:10023184-10023206 GGGGCTGAGGGAGGACAGAATGG + Intergenic
1162399430 19:10435913-10435935 TGGGCTGAGGGAGGACAGAGGGG - Intronic
1162403809 19:10461687-10461709 GGGGCTGGGGCGGGACGGAGCGG + Intronic
1162420069 19:10561127-10561149 TGGACTGCTGGGGGACAGGGTGG - Intronic
1162528663 19:11222738-11222760 GGAGGTGGTGGAGGACACAGAGG + Exonic
1162777736 19:12990074-12990096 GGGTCTGTGGGGGGACTGAGGGG - Intergenic
1162821925 19:13228334-13228356 AGGGGTGGAGGGGGAGAGAGTGG + Intronic
1162851236 19:13432515-13432537 GGGGCTGGTGGTGGAGGGATTGG + Intronic
1162861354 19:13507554-13507576 GGAGTTTGTGGGGGAGAGAGGGG + Intronic
1162899536 19:13786432-13786454 GGAGCTAGGGAGGGACAGAGAGG - Intergenic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1163161129 19:15464587-15464609 TGGGGTGGGGTGGGACAGAGAGG - Intergenic
1163254086 19:16144319-16144341 GGGGAACGTTGGGGACAGAGAGG + Intronic
1163265014 19:16215196-16215218 GGGGCGGGGGGGGGGGAGAGGGG + Intronic
1163291771 19:16383889-16383911 GGGGCCGGTGGGGCCCCGAGGGG + Intronic
1163365232 19:16872377-16872399 GTGGCTGGGTGGGGACACAGGGG - Intronic
1163418895 19:17203289-17203311 AGGGGTGGTGGGGGACATGGAGG - Intronic
1163503394 19:17689030-17689052 GGGGCTGGGGGAGTCCAGAGAGG - Intergenic
1163585252 19:18160452-18160474 AGGCCTGGTGGGGGAAACAGGGG - Exonic
1163619175 19:18348030-18348052 GGAGTTGGTGGGGTACAGAGGGG + Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1163777055 19:19224946-19224968 GGGGCGGGTGGAGGTCAGGGGGG - Intronic
1163814321 19:19454721-19454743 GGGGGTGGGGGGGGGCACAGTGG - Intronic
1164577126 19:29412013-29412035 GGGGCTGGGGAGAGAGAGAGAGG + Intergenic
1164659306 19:29949153-29949175 GGGGCGGCTGTGGGGCAGAGGGG + Intronic
1164723538 19:30450314-30450336 GGGGCTGGAGGGGGGGAGAGGGG + Intronic
1164939887 19:32244173-32244195 GCAGATGGTGGGGGGCAGAGGGG - Intergenic
1165149679 19:33753497-33753519 GGGGATGGTGGAGGATGGAGGGG - Intronic
1165149706 19:33753579-33753601 GGGGATGGTGGGAGATGGAGGGG - Intronic
1165149736 19:33753649-33753671 GTGGTTGGTGGGGGATGGAGGGG - Intronic
1165149762 19:33753709-33753731 GGGGATGGTGGGGGATGGAGAGG - Intronic
1165149827 19:33753889-33753911 GGGGATGGTGGGGGATGGAGGGG - Intronic
1165244036 19:34487678-34487700 GCGGCTGGTGGAGGAGGGAGAGG + Intronic
1165283537 19:34817850-34817872 GGGGGTTGTGGGGGAGAGATGGG + Intergenic
1165420671 19:35720626-35720648 GGTGGTGGTGGAGGGCAGAGTGG - Exonic
1165727969 19:38125462-38125484 GGGGTGGGTGTGGGACAGAGTGG - Intronic
1165770169 19:38375321-38375343 GGGGGTGGTGGGGGAATGATTGG + Intronic
1165999521 19:39870186-39870208 GGGGCTTGGGGTGGGCAGAGAGG - Intronic
1166070683 19:40385636-40385658 GGGCCTGGCGGGGGATAGAAAGG - Intronic
1166095677 19:40537589-40537611 GGGGCTGTTGGGGAGGAGAGAGG - Intronic
1166213881 19:41323609-41323631 GGGGCTGGTGGGGCTGAGAAGGG - Exonic
1166231606 19:41428115-41428137 GAGGCAGGTGGAGGGCAGAGGGG + Intronic
1166275317 19:41749609-41749631 TGGGTTGGTGGAGGGCAGAGAGG - Intronic
1166280341 19:41788406-41788428 TGGGTTGGTGGAGGGCAGAGAGG - Intergenic
1166321610 19:42022376-42022398 AGGGGTGGAGGGGGACAGAGGGG + Intronic
1166396401 19:42444338-42444360 TGGGTTGGTGGAGGGCAGAGAGG + Intergenic
1166410659 19:42553892-42553914 GGGGATGTCAGGGGACAGAGAGG + Intronic
1166514222 19:43433863-43433885 GGGGAAGCTGGGGCACAGAGAGG - Intergenic
1166541400 19:43608104-43608126 GGGCCTGGAGGGGGACAGACAGG + Exonic
1166712446 19:44945917-44945939 GGGGGTGGGTGGGGACAGAAAGG - Intronic
1166802202 19:45465259-45465281 CTGGCTGGTGGCAGACAGAGGGG + Intronic
1166839441 19:45687724-45687746 GTGCCTGGTGGGGAACAGGGAGG + Exonic
1166981657 19:46635110-46635132 GCGGCGGGAGGGGCACAGAGGGG + Intergenic
1167007311 19:46784471-46784493 GGGGATGGGGGTGGACAGGGAGG - Intronic
1167252963 19:48410696-48410718 GGACCTGGTGGGGAACAGACTGG + Intronic
1167645491 19:50703149-50703171 GGGACTTGAGGGGGACAGAGAGG - Intronic
1167846454 19:52168946-52168968 GGGGCTGGTGGTGGGGAGAATGG + Intronic
1168263770 19:55209916-55209938 GGGGCTTGTGGGAGACGGAGAGG - Intergenic
1168267875 19:55232091-55232113 AGGGCTGGGGTAGGACAGAGGGG + Exonic
1168308896 19:55451187-55451209 GGGGTGGGTGGGGGGCTGAGGGG + Intergenic
1168391968 19:56016606-56016628 GAGGCTGGTGGGGCAGAGAGTGG - Intronic
925146766 2:1587540-1587562 GGGACTGGGTGGGGACAGAGTGG - Intergenic
925285273 2:2711732-2711754 GTGTGTGGTGGGGGACAGGGTGG + Intergenic
925607559 2:5673801-5673823 GCCGGGGGTGGGGGACAGAGGGG + Intergenic
925929250 2:8694083-8694105 GGAGCTGGTGGGGGGCTGATGGG + Intergenic
925929257 2:8694094-8694116 GGGGCTGATGGGGGGCGGTGGGG + Intergenic
926044873 2:9703217-9703239 GGGGGTGGGGGGGCACAGAAGGG - Intergenic
926076982 2:9950503-9950525 GTGGCTGGTGGGGCACAGGGAGG - Intergenic
926130062 2:10297383-10297405 GTGGCTGCTGGGGAACAGGGCGG - Intergenic
926594232 2:14772484-14772506 CTGGCTGTTGGGGCACAGAGAGG + Intergenic
927060596 2:19415944-19415966 GGAGTTGGTGGGGGAAAGAAGGG - Intergenic
927172406 2:20381112-20381134 TGGGCTGCTGGGGGAGGGAGAGG - Intergenic
927240077 2:20913604-20913626 GAGGCTGCTAGGGGACACAGTGG - Intergenic
927695525 2:25237077-25237099 GTGGCTGCTGGGGGAGGGAGGGG - Intronic
927827241 2:26317375-26317397 GGGAGTGGTGGCGGAGAGAGAGG - Intronic
928167445 2:28981399-28981421 GTGGCTGGTGGGGGCCAGGGTGG + Exonic
928180487 2:29065148-29065170 AGGGCTGGGGAGGGACAGAAAGG - Intronic
928460204 2:31465445-31465467 GGAGGTGGTGGAGGACAGAATGG + Intergenic
929313097 2:40448248-40448270 GGGGATGGAAGGTGACAGAGTGG + Intronic
929413962 2:41728524-41728546 GGGGCACGTTGAGGACAGAGAGG + Intergenic
929452799 2:42048099-42048121 GGGGCCGGCGGGGCGCAGAGCGG + Exonic
929532954 2:42763843-42763865 GGGCCTGGTGGGGAACAGTTTGG - Exonic
929925132 2:46201418-46201440 GGGTCTGCTGGGACACAGAGAGG - Intergenic
929932329 2:46268360-46268382 GGGGCTGGGGGAGGAGAGAATGG + Intergenic
930371462 2:50506704-50506726 GGGGAAGGTGAGGGAGAGAGAGG + Intronic
930380466 2:50621666-50621688 GGGGCTGGGGTGGGCCAGGGTGG - Intronic
930661999 2:54063841-54063863 GGGGCTGGTGGTGGTGAAAGGGG + Intronic
931175595 2:59851249-59851271 GGTGGGGGTGGGGGACAGAGAGG + Intergenic
932554234 2:72805779-72805801 GAGGCTGGAGGAGGACAGAATGG - Intronic
932564671 2:72898376-72898398 CAGGCTGGTGGGGGAGAGGGTGG + Intergenic
932719870 2:74131024-74131046 GGGGCTGGTAGGGGATAAAGAGG + Intronic
932801823 2:74747951-74747973 GGGCATGGTGGGAGACCGAGAGG - Intergenic
932823884 2:74923181-74923203 GGGGCAAGTGGGGAGCAGAGAGG - Intergenic
933264530 2:80168192-80168214 GAGGCTGGAGGGGGAAAGAAAGG - Intronic
933289932 2:80426732-80426754 GGGGGTGGTGGAGGAAGGAGGGG - Intronic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933763077 2:85687468-85687490 GGAGATGGTGGGGGTCAGCGGGG - Intronic
933836945 2:86253485-86253507 GGTGGTGGTGGGGGACAGGCAGG - Intronic
934615735 2:95769530-95769552 GAGGCTGCTATGGGACAGAGGGG - Intergenic
934645161 2:96055027-96055049 GGGGCTGCTATGGGACAGAGGGG + Intergenic
934653248 2:96104194-96104216 GGGGGAGGAGGGGGAAAGAGGGG - Intergenic
934770999 2:96907570-96907592 GTGGGTGGAGGGGGACAGGGCGG - Intronic
934838565 2:97611116-97611138 GGGGCTGCTATGGGACAGAGGGG + Intergenic
934913380 2:98278753-98278775 GGGGGTGGTGTGGGCCAGAGTGG + Intronic
935247109 2:101228272-101228294 ACGGATGGTGGGGGGCAGAGAGG - Intronic
935523516 2:104138864-104138886 GGGGCTGTAGATGGACAGAGGGG - Intergenic
935832744 2:107017458-107017480 GGGGCTGGTGGGGGGGCGAGTGG - Intergenic
936094837 2:109523695-109523717 GGGGCTGGGGGTGGGCAGATAGG - Intergenic
936522027 2:113217557-113217579 GGAGCTGCTGGGGAGCAGAGAGG + Exonic
936662094 2:114554175-114554197 GGGGCTGGGGTGGGTCAGAGAGG - Intronic
936667281 2:114610890-114610912 GGGGGTGGTGGTGGCCTGAGGGG - Intronic
937017594 2:118619938-118619960 GGGGCTGCTGGGTGACAGCAGGG - Intergenic
937248637 2:120510032-120510054 GGGGCAGATGGGGCACTGAGAGG + Intergenic
937335435 2:121059484-121059506 AGGGCTGGGGGGCGGCAGAGGGG + Intergenic
937350399 2:121156728-121156750 GGGGATGGTGGGGGTGAGGGAGG - Intergenic
937457584 2:122055782-122055804 GGGGCTGGTGGGGGAAAGGAGGG - Intergenic
937982141 2:127622105-127622127 GGGGCTGGCAGGGGTGAGAGCGG + Intronic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
938981849 2:136534662-136534684 GGGGTTGGTGGGGGAGAAATGGG - Intergenic
939094843 2:137822634-137822656 GGTAGTGGAGGGGGACAGAGTGG - Intergenic
939175265 2:138740795-138740817 GGGGCTTGTGGGGGAAAAGGAGG + Intronic
939629701 2:144516992-144517014 GGGGCTCGAGGGGGGCAGCGGGG + Intronic
940830093 2:158457080-158457102 GGGGCCGGTGGGGGAGGGAGGGG + Intronic
940833292 2:158492493-158492515 GGGGTTGGTGTGGGGGAGAGGGG - Intronic
941161985 2:162045977-162045999 GGCGCTGGTGTCAGACAGAGTGG + Intronic
941627406 2:167844891-167844913 GGGGCTGTTAGGGGGCACAGTGG + Intergenic
942654892 2:178204992-178205014 GGGGAAGGTGGGGTACAGTGTGG - Intronic
942719916 2:178939764-178939786 GGGGGTGTTGGGGGACAAATGGG + Intronic
943001192 2:182330609-182330631 AGGGCAGGAGGGCGACAGAGGGG - Intronic
943314115 2:186364634-186364656 GGGGGTGGTGGGGGACCCAGTGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
944414984 2:199471348-199471370 GGGGGTGGTGGGGGTGAGAATGG - Intergenic
945179339 2:207075969-207075991 GGGGTTGGGGGTGGGCAGAGGGG - Exonic
945255689 2:207801249-207801271 GGGGTTGGTGGGGGGCGGGGTGG - Intergenic
945834514 2:214822789-214822811 GAGGATGGTGGGGCAGAGAGAGG + Intergenic
946088572 2:217198870-217198892 GGGCCTGGGGGTGGAGAGAGGGG - Intergenic
946333795 2:219024471-219024493 GGGGCGGGGGGGGGGCAGGGGGG + Intronic
946543030 2:220706839-220706861 AGGGCTGGTAGAGGACAGAGGGG - Intergenic
946871458 2:224089285-224089307 GGTGGTGGAGGGGGGCAGAGTGG + Intergenic
947186022 2:227456382-227456404 AGGGGTGCTGGGGGACAGGGTGG + Intergenic
947662300 2:231878709-231878731 GGGGTTGGTGGTGGCCTGAGTGG - Intergenic
947751084 2:232532750-232532772 GGGGCTGGGAGGGTACTGAGTGG + Intronic
947782129 2:232777605-232777627 GGGGCGGGGGGGGGACGGAGAGG - Intronic
947798996 2:232915511-232915533 GTGGCTGGTGGCTGTCAGAGCGG + Intronic
947810601 2:233001510-233001532 GGCCTTGGTGGGGGGCAGAGAGG + Intronic
948237522 2:236401747-236401769 GGGGTTGGTGCGGGGAAGAGAGG + Intronic
948371017 2:237489014-237489036 AGGGCTGGAGAGGGCCAGAGAGG + Intronic
948431101 2:237919656-237919678 GTGGCTGGGGTGGGGCAGAGAGG - Intergenic
948568569 2:238901902-238901924 GGGTGTGGTGGGGGAGGGAGAGG + Intronic
948642546 2:239384920-239384942 GGGCCCGGTGGGGTGCAGAGAGG - Intronic
948687397 2:239677691-239677713 AGGGCTGGTGTGGGACAGAGAGG - Intergenic
948770926 2:240250956-240250978 GCAGTTGGTGGGGGCCAGAGTGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948882770 2:240868916-240868938 GGAGCTGGTTGGGGATGGAGAGG - Exonic
949007231 2:241656558-241656580 GGGGCTGGTGGGGAGCAGGCAGG - Intronic
1169132448 20:3173250-3173272 GGGGGAGGTGGCGGCCAGAGGGG - Intronic
1169192957 20:3669424-3669446 GGGGCTGGGGAGGGGCATAGGGG + Intronic
1169231208 20:3889780-3889802 GGGGCCGGAAGGGGACAGGGTGG - Intronic
1169282246 20:4277875-4277897 TGTGCCTGTGGGGGACAGAGAGG + Intergenic
1169820724 20:9707021-9707043 GGGAATGGTGAGGGAGAGAGAGG - Intronic
1169829258 20:9805723-9805745 GGGCCTGGGGGAGGAGAGAGTGG + Intronic
1169918237 20:10705375-10705397 GGGGATGGATGGGGACAGTGGGG + Intergenic
1169927605 20:10799162-10799184 GGGGCTGGGGGATGACAGGGTGG + Intergenic
1170234330 20:14085034-14085056 GGGGGTGGTGGGGGAGAGGTGGG + Intronic
1170626172 20:18031718-18031740 GTGGCTGGTGGAGGAGAGGGGGG + Intronic
1170629393 20:18055255-18055277 TGGGCAATTGGGGGACAGAGGGG + Intronic
1171346845 20:24471478-24471500 GGGGCGGGCGGTGGAGAGAGAGG - Intronic
1171460089 20:25293157-25293179 GGGGTTGGGGGGTGGCAGAGGGG + Intronic
1171824054 20:29878599-29878621 GGGGCGGGCTGGGGGCAGAGCGG - Intergenic
1172045511 20:32077329-32077351 GTGGCTGGTTGGGGACAGGGTGG - Intronic
1172164427 20:32890283-32890305 GAGGCTGTTGGGGCAGAGAGAGG - Intronic
1172222746 20:33284929-33284951 GGGGCTGGGGAGGGACTGAATGG - Intronic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172767060 20:37356512-37356534 GGGAGTGGTGGGGGGCAGGGTGG + Intronic
1172781613 20:37439911-37439933 GGGGCAGGTGGTGGTCACAGAGG - Intergenic
1172877612 20:38175390-38175412 GGAGCTGGTGGGGGAGGGGGAGG + Intergenic
1172920458 20:38477349-38477371 GGTGCTGGTAGGGGGCAGACAGG + Intronic
1173068414 20:39736997-39737019 GGGGTTGGTGGGGCAGAGGGGGG + Intergenic
1173226893 20:41167392-41167414 AGGGCTGGCTGGGGAGAGAGAGG + Intronic
1173804027 20:45912237-45912259 GGGGCTGGGAGGGGACGGGGCGG + Intergenic
1173808965 20:45944822-45944844 GGCGCTAGTGGAGGCCAGAGGGG - Intronic
1173822419 20:46028282-46028304 GAGGCTGGCCAGGGACAGAGTGG - Intronic
1173872316 20:46349895-46349917 GGGGCAGGGAGGGGACAGTGTGG - Exonic
1174200903 20:48805694-48805716 GTGGCTGTTGGGGGGCACAGAGG - Intronic
1174278078 20:49418161-49418183 GGGGTGGCTGGGGGACAGGGTGG + Intronic
1174392168 20:50224381-50224403 GGGGGTGGTGGGGGACAGGAGGG + Intergenic
1174393362 20:50231719-50231741 GGGGCTGGTGGGGAGCAGACAGG + Intergenic
1174398030 20:50260008-50260030 GGGGCAGATGGAGGACAGAGAGG - Intergenic
1174546876 20:51332283-51332305 GGGCCTGATGGGGGATAGTGGGG - Intergenic
1174553288 20:51376517-51376539 GGGGCCGGAGAGGGACTGAGAGG + Intergenic
1174597030 20:51692485-51692507 GGGGCTGGAGGGGGAGCGTGGGG + Intronic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1175140762 20:56859067-56859089 GTCGCTGGTGGAGGACAGAAAGG - Intergenic
1175171534 20:57084761-57084783 GGAGCTGCTGGGTGACAGAATGG + Intergenic
1175252196 20:57616474-57616496 GGAGCGAGCGGGGGACAGAGAGG + Intronic
1175268926 20:57720162-57720184 TGGGCTGGTGGGGGGCAGTGCGG + Intergenic
1175272907 20:57747228-57747250 GGGGTTGGCGGGGACCAGAGGGG + Intergenic
1175276646 20:57775170-57775192 GGGCCTGGGTTGGGACAGAGGGG + Intergenic
1175529150 20:59662308-59662330 GGGTGGGGTGGGGGACACAGAGG + Intronic
1175755719 20:61528446-61528468 GGGGGTGGAGGGGGAGAGGGAGG + Intronic
1175927912 20:62480062-62480084 GGGGCTTCTGGGGGCCTGAGTGG + Intergenic
1175929695 20:62487833-62487855 GGGGCTGGGGGTGGAGGGAGAGG + Intergenic
1175964461 20:62653545-62653567 GGGGCTGCGAGGGGACACAGGGG - Intronic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176070505 20:63223879-63223901 GGGGTCGGTGGGGGGCAGAGGGG - Intergenic
1176072410 20:63234136-63234158 GGGGGCGGTGGAGGACAGGGAGG + Intergenic
1176107354 20:63395679-63395701 GGGGCTGGAGGTGGACTGGGAGG + Intergenic
1176115375 20:63429778-63429800 GAGGCTGGTGGGGTGCAGGGAGG - Intronic
1176233343 20:64042771-64042793 GGGGGTCGTGGGGGACGGGGCGG + Intronic
1176233363 20:64042812-64042834 GGGGGTCGTGGGGGACGGGGCGG + Intronic
1176233384 20:64042854-64042876 GGGGGTCGTGGGGGACGGGGCGG + Intronic
1176233395 20:64042875-64042897 GGGGGTCGTGGGGGACGGGGCGG + Intronic
1176233416 20:64042917-64042939 GGGGGTCGTGGGGGACGGGGCGG + Intronic
1176233444 20:64042979-64043001 GGGGGTCGTGGGGGACGGGGCGG + Intronic
1176522536 21:7835376-7835398 GGGGGTGGAGAGTGACAGAGGGG - Intergenic
1178228631 21:30754551-30754573 GGAGCTGGAGGGGGAAAGGGAGG - Intergenic
1178600272 21:33988573-33988595 GGAGCTGGTGGGGGTTAGAAGGG - Intergenic
1178656556 21:34465388-34465410 GGGGGTGGAGAGTGACAGAGGGG - Intergenic
1178958115 21:37041649-37041671 GGGGATGGTGGGTGGCAGTGAGG - Intergenic
1178992355 21:37366615-37366637 GTGGTTGGCTGGGGACAGAGGGG + Intronic
1179193197 21:39140795-39140817 GGGGGTGGTGGGGGAGAAAAAGG - Intergenic
1179211086 21:39324950-39324972 GGGGCTGGAGGTGGAAGGAGGGG + Intergenic
1179266753 21:39810322-39810344 GGGGTTGGTAGGGCACAGGGAGG - Intergenic
1179399856 21:41073881-41073903 GGGCCTAGCGTGGGACAGAGGGG - Intergenic
1179435517 21:41359654-41359676 GGGGCTGGTGAGGCACAGAGAGG + Intergenic
1179455448 21:41496664-41496686 TGGGCTGGTGGGGCCCAGAGTGG - Intronic
1179719407 21:43306776-43306798 GGGGCTGGTGGAGGGAGGAGGGG - Intergenic
1180096246 21:45556403-45556425 GGCGCTGGTGGGGAGCAGCGGGG - Intergenic
1180198644 21:46212059-46212081 GGGGCAGGGAGGGGACAGGGAGG + Intronic
1180201436 21:46227198-46227220 GGGGCTGTAGGTGGGCAGAGTGG - Intronic
1180224292 21:46380570-46380592 GGGTGGGGTGGGGGACAGAATGG - Intronic
1180232577 21:46436193-46436215 GGGCCGGGTCTGGGACAGAGGGG - Intronic
1180762288 22:18219885-18219907 GGGGGTGGTGGGGGAGGGGGAGG - Intergenic
1180773379 22:18404723-18404745 GGGGGTGGTGGGGGAGGGGGAGG + Intergenic
1180804730 22:18654272-18654294 GGGGGTGGTGGGGGAGGGAGAGG + Intergenic
1180806014 22:18715138-18715160 GGGGGTGGTGGGGGAGGGGGAGG - Intergenic
1180956546 22:19743826-19743848 GGGGCTGGGGATGGGCAGAGGGG - Intergenic
1180961727 22:19765430-19765452 GTGGGGGGTGGGGAACAGAGCGG - Intronic
1180994658 22:19959538-19959560 GGGGCTGGGGCGGGGCGGAGCGG + Intronic
1181028795 22:20140265-20140287 GGGGCTGCATGGGGACAGGGTGG + Intronic
1181039246 22:20184205-20184227 GGAGCTTGTGGGGTACATAGGGG - Intergenic
1181039262 22:20184262-20184284 GGGGCTTGTGGGGTACATAGGGG - Intergenic
1181039328 22:20184452-20184474 GGGGCCTGTGGGGTACATAGGGG - Intergenic
1181176773 22:21042291-21042313 GGGGCTGATGGAGGAATGAGGGG + Intergenic
1181192475 22:21151656-21151678 GGGGGTGGTGGGGGAGGGGGAGG + Intergenic
1181216964 22:21340919-21340941 GGGGGTGGTGGGGGAGGGGGAGG - Intergenic
1181284111 22:21739797-21739819 GAGGCTGGTGAGGAAGAGAGTGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1181939204 22:26462363-26462385 AGGGCAGTGGGGGGACAGAGAGG + Intronic
1181998413 22:26901490-26901512 CAGGCTGGTGGGGGACTGGGAGG + Intergenic
1182074845 22:27488456-27488478 GGTGCTGGTGGGGGCCAGGGAGG + Intergenic
1182109837 22:27715310-27715332 CAGGCGGGTGGGGGACAGAAGGG - Intergenic
1182358026 22:29731020-29731042 GGGGCAGGTGGAGGAGAGTGAGG + Exonic
1182546561 22:31080177-31080199 GGGGCTGGGGGGTGTCACAGAGG + Intronic
1183197733 22:36364987-36365009 GGGGCTGGTGGGGGTGGGGGTGG - Intronic
1183334189 22:37237278-37237300 GGGGCCAGAGGGGAACAGAGGGG + Intronic
1183429120 22:37755211-37755233 GGGGCTGGTGGTGGGCAGCATGG + Intronic
1183465529 22:37978361-37978383 TGGGCTGGAGGGTGAGAGAGGGG + Intronic
1183471176 22:38007516-38007538 GGAGCTGGCGGTGGACAGAGCGG + Intronic
1183471199 22:38007615-38007637 GTGGCTGGCAGGTGACAGAGAGG + Intronic
1183485521 22:38085997-38086019 GGGGCTGGGGGAGGCCAGGGAGG - Intronic
1183502464 22:38189041-38189063 GGGGATGGTGGGGGATGGAGAGG + Intronic
1183502482 22:38189081-38189103 GGGGATGGTGGGGGATGGTGGGG + Intronic
1183502485 22:38189091-38189113 GGGGATGGTGGGGGATGGAGAGG + Intronic
1183502502 22:38189141-38189163 AGGGATGGTGGGGGATGGAGAGG + Intronic
1183502519 22:38189191-38189213 AGGGATGGTGGGGGATGGAGAGG + Intronic
1183580830 22:38725741-38725763 GGCAGTGGTGGAGGACAGAGAGG + Intronic
1183675508 22:39296991-39297013 GGGGCTGGTGGGGAACAGGCGGG + Intergenic
1183689736 22:39381953-39381975 GGGGCTGGGTGTGGAGAGAGGGG - Exonic
1183691601 22:39392771-39392793 GGGGCTGTGTGGGGACAGTGGGG - Intergenic
1183715736 22:39532520-39532542 GGGGCTGTAGGGGAAGAGAGAGG + Exonic
1183909610 22:41068601-41068623 GGTGGTGGTGGGGGACAGAAAGG - Intergenic
1184090930 22:42292750-42292772 GGGGCTGGCTGGGAGCAGAGAGG - Intronic
1184119022 22:42438412-42438434 AGGGCAGGTGGGGGGCAGAAGGG - Intergenic
1184145904 22:42610388-42610410 GAGGTTGTTGGGGGACAGGGTGG - Intronic
1184177364 22:42795877-42795899 GGGGCTGGGGGGAGACTGAGGGG + Intergenic
1184177372 22:42795896-42795918 GGGGCAGGGGGGAGACCGAGGGG + Intergenic
1184340953 22:43885527-43885549 GGGGTTGGTGAGGGACAGCCAGG - Intronic
1184355756 22:43978529-43978551 GGGGTGGCTGGAGGACAGAGGGG + Intronic
1184583288 22:45431087-45431109 GGGCCAGGTGGGGGACCGGGTGG + Intronic
1184732595 22:46378882-46378904 GGGGCTGGTGAGGAACACGGTGG - Intronic
1184945017 22:47796572-47796594 GGGGGTGGGGCTGGACAGAGGGG + Intergenic
1184953053 22:47859768-47859790 GAGGCTGGGGAGGTACAGAGGGG - Intergenic
1185030072 22:48438014-48438036 GGCGCAGGTGAGGGACACAGTGG - Intergenic
1185089494 22:48757758-48757780 AGGGCTGGTGGAGGACAGGATGG + Intronic
1185226850 22:49658187-49658209 GGAGCAGGTAGGGGACTGAGGGG - Intergenic
1185239414 22:49734673-49734695 GGGGCAGGTGTGCGACCGAGGGG - Intergenic
1185275975 22:49950372-49950394 GGGGGATGTGGGGGACAGGGGGG + Intergenic
1185296973 22:50059138-50059160 GGGGCTGGTGGGGGACTTGAAGG + Intergenic
1185377604 22:50489326-50489348 GGGGGCGGTGGGGGACGGTGGGG + Intronic
1185417195 22:50716685-50716707 GGGAGTGGTGAGGCACAGAGGGG - Intergenic
1203235209 22_KI270731v1_random:145705-145727 GGGGGTGGTGGGGGAGGGGGAGG + Intergenic
949295294 3:2514667-2514689 GGGGCTATTGAGGCACAGAGAGG - Intronic
949989888 3:9570120-9570142 GGGGCGGCTGCGGGGCAGAGGGG - Intergenic
950138558 3:10600104-10600126 GGGGCTGGTGGGGGGCCATGGGG + Intronic
950202861 3:11057198-11057220 GGGGGTGGTGGTGGCCAGAAGGG - Intergenic
950212062 3:11131011-11131033 AGGGATGGTGGGGGAGAGAGAGG - Intergenic
950565505 3:13767428-13767450 GGGGCTGGGGTGGGACACTGGGG + Intergenic
950576996 3:13837970-13837992 GGGGCTGTTGCGGGGCAGCGTGG - Intronic
950731398 3:14962450-14962472 GGGGCTGGTTCAGCACAGAGTGG + Intronic
952254321 3:31682387-31682409 GGGGCAGGTGGAGGTCAGGGAGG - Intronic
952281870 3:31931282-31931304 GGGGCTGGGGGTGGAGAGTGGGG - Intronic
952460617 3:33521875-33521897 GGGGCTGGTGGAGGGGGGAGTGG - Intronic
953535725 3:43775300-43775322 GGGGCTGGTGTGTGTCAGGGTGG + Intergenic
953666538 3:44929892-44929914 TGAGCTGATGGGGCACAGAGGGG - Intronic
953859821 3:46534070-46534092 GGGGCTGGTGGGGCAAGGGGAGG - Intronic
954446516 3:50549784-50549806 TGGGCAGCTGGGGGACAGAAGGG - Intergenic
954683702 3:52359405-52359427 GGGGGTGGAGGGGGACAGACAGG - Intronic
954812138 3:53255139-53255161 GGGGCTGATTGGGGGAAGAGGGG - Intronic
955220198 3:57016968-57016990 AGGCCTGGTGGGGGAGAGAGAGG + Intronic
955674434 3:61434625-61434647 GGGGCGGCTGGCGGGCAGAGGGG + Intergenic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
956144679 3:66180710-66180732 GGGCGGGGTGGGGGACAGAGAGG + Intronic
956202778 3:66723497-66723519 GGGGTTGGTGGTGGACAGGCAGG - Intergenic
956756270 3:72390468-72390490 GGGGCTGGGAGGGCACAGATTGG + Intronic
958422266 3:93942195-93942217 GGGAGTGGAGGGGGGCAGAGCGG - Intronic
959045116 3:101465169-101465191 GGTGCTGATGGTGGGCAGAGTGG - Intronic
959419196 3:106111459-106111481 GGGGCGGCTGGCGGGCAGAGGGG + Intergenic
959551015 3:107657535-107657557 GGGGATGTAGAGGGACAGAGAGG + Intronic
959778247 3:110197104-110197126 ATGGTTGGTGGGGGACAAAGTGG - Intergenic
959881446 3:111448550-111448572 TGGGCTGGTAGGGGTCAGAGGGG - Intronic
960097094 3:113699161-113699183 GGGGCAGGCGGGGAAAAGAGGGG - Intergenic
960106500 3:113803252-113803274 GGGGCTGGGGGAGGAGAGAAAGG + Intronic
960584821 3:119311045-119311067 GGAGCTGGAGGCAGACAGAGGGG - Intronic
960602403 3:119470886-119470908 AGGGCTTGTGGGGGAGAGTGTGG + Intronic
960623761 3:119660661-119660683 GGGGGTGGTGGGGAGGAGAGAGG - Intronic
960868964 3:122230511-122230533 GGGGATGGTGGCGCAGAGAGGGG - Intronic
961028028 3:123578031-123578053 GGGGCTGTGGGGAGAGAGAGTGG - Intronic
961073523 3:123961090-123961112 GGGGATGGAGAGGGACAGGGGGG - Intronic
961094475 3:124142714-124142736 GAGGCTGGAGGAGTACAGAGTGG - Intronic
961310045 3:125990730-125990752 GGGGATGGAGAGGGACAGGGGGG + Intergenic
961386183 3:126524566-126524588 GGCGCTGGTGAGGCACAGAAAGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961665952 3:128493192-128493214 GCGGCCGGTGGGGGAGAGAGAGG - Intergenic
961816786 3:129555258-129555280 GGGGCTGGAGGGGGGCAGCTGGG - Exonic
962189616 3:133296713-133296735 GGGGCTGTTGATGGACAGTGGGG + Intronic
963929793 3:150991844-150991866 GGGGAAGGTGGGGGAGTGAGGGG - Intergenic
964642594 3:158925979-158926001 GTGGCTGGTGTGGGAAAGAGTGG + Intergenic
964840773 3:160991171-160991193 TGGGCTGGTGGGCCACAGATTGG + Intronic
964969504 3:162542253-162542275 GGGGATGGAGGCAGACAGAGGGG - Intergenic
965010248 3:163078459-163078481 TGGGGTGTTGGGGGACAGACAGG + Intergenic
965414636 3:168377696-168377718 GGGACTGGTGGGGGAAGGTGGGG - Intergenic
966350999 3:179032753-179032775 GGGGCGGCTGCGGGGCAGAGGGG - Intronic
966712545 3:182984586-182984608 GGGGGTGGTGGGGTAGAGAGAGG - Intronic
966790793 3:183667593-183667615 GGGGCTGGTGGGGGACTGGTCGG - Intronic
966868514 3:184275942-184275964 GGGGAGGGTGGGGGAGAGGGAGG - Intronic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
967094393 3:186164870-186164892 GAGGCTGTTGGGTGACAAAGAGG + Intronic
967424589 3:189311905-189311927 AGGGCTTCAGGGGGACAGAGTGG + Intronic
968089603 3:195892066-195892088 TGGGCTGGAGGGGGACTTAGAGG - Intronic
968232291 3:197011117-197011139 GGGGCTGGCAGGGCACAGGGAGG - Intronic
968442460 4:630798-630820 GGGGCTGGTGAGACACAAAGAGG + Intronic
968453099 4:684256-684278 GGGGCAGCTGTGGGACGGAGCGG - Intronic
968480843 4:832429-832451 GAGGCTGGTGTGGCTCAGAGAGG + Intergenic
968534133 4:1113101-1113123 GGGGCGCGTGGGGGGCCGAGGGG - Intronic
968581422 4:1397088-1397110 GAGGCAGGTGGGGGCCACAGTGG + Intergenic
968584340 4:1409161-1409183 GAGGATGGTGTGGGGCAGAGAGG - Intergenic
968605163 4:1531977-1531999 GCTGCTGATGGGGGACAGAGCGG - Intergenic
968618534 4:1593122-1593144 GGAGCCGGTGGCGGCCAGAGAGG + Intergenic
968653500 4:1769118-1769140 TGGGCATGTGGGGGGCAGAGGGG - Intergenic
968659654 4:1793734-1793756 GGGGCGGCTGGGGGTCGGAGGGG + Intronic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968740872 4:2331094-2331116 GGGGCTGGGGAGGGAGGGAGGGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969130059 4:4984407-4984429 GGGGCAGGTGGGGGAAGGACAGG + Intergenic
969334031 4:6496328-6496350 TGGGCTGGTGGGGTCCAGATGGG - Intronic
969450286 4:7269018-7269040 GGGCCTGGTGGTTGGCAGAGCGG + Intronic
969522698 4:7687871-7687893 GAGGCTGATGGGGGATAGCGAGG - Intronic
969531729 4:7734181-7734203 GGGACGGGTGGGGGACAGACGGG + Intronic
971013887 4:22467757-22467779 TGGGTTGGTGGGGGAAAAAGGGG - Intronic
971195929 4:24471815-24471837 GGGGGGGGTGGGGTGCAGAGTGG - Intergenic
971307632 4:25497458-25497480 GGAGCTGATGGGGGAGAGAAAGG - Intergenic
971735923 4:30452030-30452052 GGGGAAGGAGGGGGAAAGAGCGG - Intergenic
971952653 4:33374060-33374082 GGGCCTGTTGGGGGAGAGAAGGG + Intergenic
972274158 4:37541496-37541518 GGGGCTGGTAGAGGGCGGAGAGG - Intronic
972351702 4:38242263-38242285 GAGGCTGATGGGGGAAAAAGAGG - Intergenic
972720210 4:41688794-41688816 GGTGCTGCAGGGGTACAGAGAGG + Intronic
974056400 4:56987465-56987487 GGAGCTGATGGGGCTCAGAGAGG - Intronic
975165002 4:71168588-71168610 GGGGGTGGTGGGGGAAAGTGGGG - Intergenic
975976805 4:80106948-80106970 GGGGCAGGTGGTGGAGTGAGAGG + Intronic
975997829 4:80336576-80336598 CAGGGTGGTGGGGGACAGAGTGG + Intronic
976428518 4:84934810-84934832 GGGGGTGGTGGGGATAAGAGAGG - Intronic
977520170 4:98072397-98072419 GGGGCCTGTGGGGTGCAGAGAGG + Intronic
977708116 4:100093819-100093841 GGGGTCCCTGGGGGACAGAGTGG + Intergenic
978644718 4:110916085-110916107 GGAGTGGGTGAGGGACAGAGTGG + Intergenic
978661416 4:111131476-111131498 GGGGCTCTTGGGGGAAAGTGGGG - Intergenic
980920792 4:139083989-139084011 GGGGCGGCTGGGGGAAAGGGGGG - Intronic
981342488 4:143637865-143637887 GGGGCAGGTGGTGGAGGGAGAGG + Intronic
981537677 4:145816625-145816647 TAGGCTGGTGGGGGACAGATGGG + Intronic
981868641 4:149459605-149459627 GGGGCTGGGGGAGGAGAGAGTGG - Intergenic
982361945 4:154527716-154527738 GGGGCGGGTAGGGAACAGTGTGG + Intergenic
982396458 4:154920495-154920517 GGTAGTGGAGGGGGACAGAGTGG + Intergenic
983900098 4:173124511-173124533 GGGGAAGATGGGGGACAGATAGG - Intergenic
984810474 4:183791907-183791929 GGGGCAGGGAGGGGAAAGAGAGG + Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
985393352 4:189514898-189514920 GGGGATGGTGGGGGGCAGGTGGG - Intergenic
985452963 4:190070920-190070942 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985453952 4:190074213-190074235 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985454940 4:190077506-190077528 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985456911 4:190084097-190084119 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985457899 4:190087393-190087415 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985458887 4:190090690-190090712 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985463139 4:190173453-190173475 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985894012 5:2738692-2738714 GGGGGTGGTGAGGGTCAGATGGG - Intergenic
986006373 5:3672268-3672290 GGGGCTGGTGGGGCCAAGTGAGG + Intergenic
986406644 5:7432178-7432200 GGAGCTGAAAGGGGACAGAGCGG - Intronic
987034328 5:14005122-14005144 GCCACTGGTGGGGGACTGAGTGG - Intergenic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
987159222 5:15123511-15123533 GAGGCTGGTTGGAGCCAGAGTGG - Intergenic
989261561 5:39424709-39424731 GGGGCGGGGGGGTGAGAGAGGGG + Intronic
989459260 5:41678363-41678385 GGGGATGCTGGGGGGAAGAGGGG + Intergenic
989533825 5:42540682-42540704 GGGGGCGGTGGTGGATAGAGGGG - Intronic
989676200 5:43976008-43976030 GGGCCTGTTGGGGGACACAAGGG - Intergenic
990051511 5:51507172-51507194 GGGGCTGGGCGGGGGCAGTGGGG - Intergenic
990675586 5:58181153-58181175 GGGGCTTATTGGGGACAGGGAGG + Intergenic
991954082 5:71974652-71974674 GGGACTAGTGGGGGACAGTAGGG + Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993038855 5:82788972-82788994 AGGGCTGGTGGGGGAAGGAATGG + Intergenic
993426019 5:87765014-87765036 GGGGGAGGTGGGGGACTGGGGGG + Intergenic
993966991 5:94371041-94371063 GGAGCTGGTGGGGGAGCGGGTGG + Intronic
994355769 5:98792578-98792600 GGGGTTGGTGGGGGGCGGGGGGG - Intronic
995975375 5:118029344-118029366 GGCTCTGGTCGGGGACAGTGGGG - Intergenic
996577600 5:124993530-124993552 GGGCCTGGTGGGGTTGAGAGAGG + Intergenic
997474158 5:134133137-134133159 TGGGATGGTGGGGGAGACAGAGG + Intronic
997475778 5:134141629-134141651 GGGGCTGCCGGGGAACGGAGAGG + Intronic
997592789 5:135086096-135086118 GGGGCTGGTGCAGGAAAGGGAGG - Intronic
998140601 5:139697534-139697556 CTGGCTGGTGGGGGGCGGAGTGG + Intergenic
998207025 5:140165276-140165298 GAGAATGGTGGGGGACAGGGTGG + Intergenic
998549107 5:143059555-143059577 GGGACTGGAGGGGGAAAGGGTGG - Intronic
998903719 5:146881059-146881081 GGGCGGGGTGGGGGAGAGAGTGG + Intronic
999143720 5:149379333-149379355 GGGGCTGCTGGGGGAGTGAGTGG + Intronic
999145468 5:149390320-149390342 GGGACTGGTCGGGGACAGAATGG + Intronic
999314221 5:150573912-150573934 GGGGTGGGTGGGGAACGGAGGGG + Intergenic
999758475 5:154682718-154682740 TGGGCTGGGGGAGGACAGTGGGG - Intergenic
1000379380 5:160615227-160615249 CGGGCTGGGGGGAAACAGAGTGG - Intronic
1000983332 5:167840532-167840554 GGGGCTGGGGGAGGAAGGAGGGG - Intronic
1001085572 5:168697932-168697954 GTGGCTGGTCGAGGAAAGAGAGG + Intronic
1001179241 5:169503246-169503268 GGGGCTGGGGGGAGAGAAAGGGG - Intergenic
1001550992 5:172602358-172602380 GGGACTGGAGGGGGTCACAGTGG - Intergenic
1001576944 5:172770889-172770911 GGCGCTGCTGGGGGAGCGAGCGG - Exonic
1001636253 5:173212536-173212558 GTGGCTGCTGGGGGCTAGAGAGG + Intergenic
1001865946 5:175105497-175105519 GAGGCTGCTGAGGCACAGAGAGG - Intergenic
1001933549 5:175689255-175689277 TGGGCTGAGGGGGGCCAGAGGGG - Intergenic
1001948717 5:175801044-175801066 GGGGCAGGGAGGGGGCAGAGAGG + Intronic
1002103551 5:176869026-176869048 GTGGCTGGTGGGGTGAAGAGAGG + Intronic
1002306513 5:178286820-178286842 GAGGCTGGTGGGGAACGGACCGG + Intronic
1002340549 5:178514062-178514084 GGGGCTGGGGGAGGAGAAAGTGG - Intronic
1002401750 5:178994957-178994979 CGGGCTGCGGGGAGACAGAGGGG + Exonic
1002422257 5:179154779-179154801 GGGAAGGGTGGGGCACAGAGGGG - Intronic
1002485733 5:179534934-179534956 TGGGCAGGTGGGGGGCGGAGGGG + Intergenic
1002934727 6:1661863-1661885 GGGGCGGGTGGGTGCCTGAGGGG + Intronic
1003114329 6:3273378-3273400 GGGGCTGGTGCTGGCCAGCGCGG - Exonic
1003229193 6:4234959-4234981 GGGGCTGGTCGGGGGCTGTGGGG + Intergenic
1003556777 6:7146787-7146809 GGAGGTGGTGGGGGAGGGAGAGG + Intronic
1004080394 6:12386767-12386789 GGGGGTGGTGGGGGAGGGTGAGG + Intergenic
1004243841 6:13953380-13953402 GTGTATGGTGGGGGGCAGAGGGG + Intronic
1004591860 6:17059700-17059722 GGGGTTGGTGGGGGGCAGGAGGG - Intergenic
1004854023 6:19731253-19731275 GGGGGTGGTGGGGGACTGTGGGG - Intergenic
1004924434 6:20403586-20403608 GGCGCTGGAGGGGGAGAGGGGGG + Intronic
1004963318 6:20817995-20818017 AGGACTGATGGGGGTCAGAGTGG - Intronic
1005138190 6:22596048-22596070 GGTGCTGGTGGGGGCAGGAGAGG - Intergenic
1005726758 6:28656882-28656904 GGAACTGATGGGGGAAAGAGTGG + Intergenic
1005838785 6:29726262-29726284 GGTGTTGGGGGGGAACAGAGGGG + Intronic
1006029841 6:31170685-31170707 GGGACTGGGGAGGGAGAGAGGGG - Exonic
1006098137 6:31668999-31669021 GGGAGGAGTGGGGGACAGAGTGG + Intronic
1006102081 6:31691745-31691767 GGGGTGGGTGGGGGTGAGAGGGG + Intronic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006374352 6:33663637-33663659 TGGGCTGGAGGGAGACAGATGGG + Intronic
1006466394 6:34197144-34197166 GGGGCGGGGGGGGGGCTGAGGGG - Intergenic
1006601920 6:35231912-35231934 GGGGCTGCTGAGGGACAGCTGGG - Intronic
1006610608 6:35292279-35292301 GGGGCTGGTAGGGGGCACTGGGG - Intronic
1006639694 6:35483601-35483623 AGGGCTGGCTGGAGACAGAGAGG - Intronic
1006671106 6:35730205-35730227 GTGGCTGGTGGGGAAGGGAGAGG + Intergenic
1006929764 6:37680726-37680748 GGGGCTGCTGAGGCCCAGAGGGG - Intronic
1007209516 6:40181114-40181136 GGGGCTGGTTGGGGGGAGAGGGG - Intergenic
1007266207 6:40598115-40598137 AGGGCTAATGGGGCACAGAGTGG - Intergenic
1007337375 6:41163241-41163263 GGTGCAGGGTGGGGACAGAGGGG + Intergenic
1007394771 6:41571143-41571165 GGTGGTGGTGGGTGACCGAGTGG - Intronic
1007458188 6:41997064-41997086 TGGGCTGGCTGGGGACAGACAGG - Intronic
1007473855 6:42106686-42106708 GGGGGTGCTGGGGGAGGGAGGGG + Exonic
1007590951 6:43020789-43020811 GGAGCAGGTGGGTGACAGATGGG - Exonic
1007732319 6:43954691-43954713 GGGGAGGGTGGAGGGCAGAGGGG - Intergenic
1007774591 6:44217939-44217961 GGAACTGCTGGAGGACAGAGGGG - Intergenic
1007854059 6:44835735-44835757 GGGAGTGGGGTGGGACAGAGAGG - Intronic
1007938057 6:45751492-45751514 GGTGGTGGTGGGTGATAGAGGGG - Intergenic
1008539304 6:52533075-52533097 GGGGCTGTTGGGGGCTAGAGGGG + Intronic
1008766228 6:54918838-54918860 GGGGATGCTGGAAGACAGAGAGG - Intronic
1010304603 6:74304462-74304484 GGGGCTTGTTGGGGGCAGTGTGG + Intergenic
1010926819 6:81753850-81753872 GGGGCTGAGGTGGGGCAGAGGGG + Intergenic
1011474478 6:87737454-87737476 GGGGCAGGTGGGAGAGTGAGGGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1011632307 6:89339488-89339510 GGGGATGGGGGAGGAGAGAGGGG + Intronic
1012384259 6:98659812-98659834 GGGGCTGGTTGGGGGCAAAGGGG - Intergenic
1012476010 6:99614776-99614798 GGGGCGGGGTGAGGACAGAGAGG + Intronic
1012494580 6:99820060-99820082 AGCTCTGGTGGCGGACAGAGTGG - Intergenic
1012522981 6:100143075-100143097 GTGGTGGGCGGGGGACAGAGGGG + Intergenic
1012887168 6:104859513-104859535 GGGGCTGGGGGCGGCCAGTGGGG - Intronic
1013368240 6:109450305-109450327 GGGACTGGTGGGGGACTGCCTGG - Exonic
1013368822 6:109453773-109453795 GGCGCTGCTGGGGGCCCGAGTGG - Exonic
1013588124 6:111597415-111597437 GGGGCTGGAGGGGGCCTGTGTGG - Intronic
1014416371 6:121190135-121190157 GAGGGTGGTGGGGGACGGAGAGG - Intronic
1014473586 6:121845957-121845979 GGGGAAGGTGGGGCAAAGAGTGG + Intergenic
1014695020 6:124609594-124609616 GAGGCAGGTGGAGGACAGAGTGG - Intronic
1015946550 6:138507865-138507887 GGGAGTGGTTGGGGACAGAAAGG + Intronic
1016864563 6:148752436-148752458 GGGGTTGGTTGGGGACACAGTGG + Intronic
1017381141 6:153831573-153831595 GGTGCTGGAGGGAGACAGAGAGG + Intergenic
1017400068 6:154050613-154050635 GGGGCTGATGGGGGGCTGGGAGG + Intronic
1017626854 6:156357880-156357902 GAGGCTATTGAGGGACAGAGAGG - Intergenic
1017641412 6:156497898-156497920 GGTGCTGGTGGATAACAGAGTGG + Intergenic
1017978975 6:159382031-159382053 GGGGGTGGTGGGGGAAAATGTGG - Intergenic
1018356951 6:163027918-163027940 GTGGTTGGTGGGGGACAGTGTGG - Intronic
1018681086 6:166265940-166265962 GGGGCTTGAGGAGGACAGGGAGG + Intergenic
1019112983 6:169732439-169732461 GGGCCTGTTGGGGGTGAGAGTGG - Intergenic
1019258088 7:64409-64431 TGGGTTGGTGGGGAATAGAGGGG - Intergenic
1019283669 7:212962-212984 GGGGCTGGAGGCGGACAAGGGGG - Intronic
1019345085 7:525730-525752 GGGGCTGGAGGAGGACAGGGAGG + Intergenic
1019467399 7:1196877-1196899 GGGGCAGGTGGGGGAAACACAGG + Intergenic
1019515361 7:1437644-1437666 GGGCCAGGCGGGGGACAGGGCGG - Intronic
1019631367 7:2051619-2051641 GGGGGAGGTGGGGGACAGCAAGG - Intronic
1019631390 7:2051677-2051699 GGGGGAGGTAGGGGACAGCGAGG - Intronic
1019709492 7:2511734-2511756 GGGGGTGGTGGGGGATGGAGGGG + Intergenic
1019775440 7:2909621-2909643 CGGAGTGGTGAGGGACAGAGGGG - Intronic
1020083115 7:5296863-5296885 GGGGCTGGGGCGGGACGGGGCGG + Intronic
1020200331 7:6074828-6074850 GAGGGTGGTAGGGAACAGAGTGG - Intergenic
1020257054 7:6508250-6508272 GGCGGTGGTGGGGGGCTGAGCGG + Exonic
1021172985 7:17418155-17418177 GGTAGTGGAGGGGGACAGAGTGG - Intergenic
1022403965 7:30069185-30069207 GAGGCTGGTGGGAAACAGATAGG - Intronic
1023863025 7:44226875-44226897 GGGGAGCTTGGGGGACAGAGAGG + Intronic
1023863041 7:44226931-44226953 AGGGAACGTGGGGGACAGAGGGG + Intronic
1023863072 7:44227007-44227029 GGTGGGTGTGGGGGACAGAGGGG + Intronic
1023863143 7:44227213-44227235 GGGGGATGTGGGGGACAGAGGGG + Intronic
1023863245 7:44227504-44227526 GGAGGGTGTGGGGGACAGAGGGG + Intronic
1023863315 7:44227710-44227732 GGTGGGTGTGGGGGACAGAGGGG + Intronic
1023863361 7:44227863-44227885 GGGGAATTTGGGGGACAGAGGGG + Intronic
1023870501 7:44260833-44260855 GGGGCTTGGTGGGGGCAGAGAGG - Intronic
1023888585 7:44377234-44377256 GGAGCAGGGTGGGGACAGAGTGG - Intergenic
1023940382 7:44765521-44765543 GGGGCTGCAGGGGGGCAAAGGGG - Exonic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024045451 7:45582578-45582600 GGGGGTGGTGGGGGATGGGGTGG + Intronic
1024062010 7:45704921-45704943 GGGGCTGGTGGGGGAGGGACTGG - Intronic
1024233780 7:47382663-47382685 GGGGGTGGTGGGGGACTGGGGGG - Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024751047 7:52466107-52466129 GTGGCAGGTGGAGCACAGAGAGG + Intergenic
1024833815 7:53493043-53493065 AGGGCTGGAGGGGGAAAAAGGGG - Intergenic
1025211167 7:57020325-57020347 GGGGCTGGGGCGGGGCAGGGCGG - Intergenic
1025211178 7:57020346-57020368 GGGGCTGGGGCGGGGCGGAGCGG - Intergenic
1025211188 7:57020367-57020389 GGGGCTGGGGCGGGGCGGAGCGG - Intergenic
1025660767 7:63556480-63556502 GGGGCTGGGGCGGGGCGGAGCGG + Intergenic
1025660777 7:63556501-63556523 GGGGCTGGGGCGGGGCGGAGCGG + Intergenic
1025660788 7:63556522-63556544 GGGGCTGGGGCGGGGCAGGGCGG + Intergenic
1026517275 7:71084065-71084087 GGGGAGGGTGGGGGACGGAAGGG - Intergenic
1026850704 7:73721560-73721582 GGGGGTGGTGGAGGGCACAGCGG - Intergenic
1026863746 7:73810489-73810511 GGGGCTCCTGGTGGGCAGAGGGG - Intronic
1026909568 7:74084187-74084209 CGGGCGGGAGGGGGACAGGGAGG - Intronic
1026958103 7:74390753-74390775 GGGGTGGGTGGGGGACTGGGCGG + Intronic
1026968110 7:74453267-74453289 GGGGCTGGTTGGGGGGACAGGGG + Intergenic
1027051735 7:75025237-75025259 GGGGCTGGTGAGGCTCAGACAGG + Intergenic
1027175415 7:75899939-75899961 GGGCCTTGTGGAGCACAGAGAGG + Intronic
1028024513 7:85820960-85820982 GGGAATGGTGGGGGACAGAGTGG - Intergenic
1028802010 7:94977102-94977124 GGGGCTTGTGGGAGTAAGAGGGG + Intronic
1028985084 7:97003232-97003254 GTGGGGGGTGGGGGACAGAAGGG - Intergenic
1029480008 7:100806636-100806658 GAGGCAGGTGGGGGACTGGGGGG - Intronic
1029483789 7:100827422-100827444 GGGGATGGTGGGAGCCCGAGCGG + Exonic
1029893886 7:103960781-103960803 AAGGATTGTGGGGGACAGAGCGG - Intronic
1029978755 7:104858594-104858616 GGGGCTGTTGGGGTTCAGTGAGG - Intronic
1030319065 7:108145476-108145498 GGTGGTGGTGGGGGAAGGAGGGG + Intergenic
1030873424 7:114785168-114785190 CGTGCTTGTGGGGGAAAGAGAGG - Intergenic
1030982970 7:116208505-116208527 GGGGCTGGTGGTGGACATAAAGG - Intergenic
1032082473 7:128866590-128866612 GGGGCGGGTGGGGGTGAGAGTGG - Intronic
1032412185 7:131704082-131704104 AGCGATGGTGGGGGGCAGAGGGG + Intergenic
1033245538 7:139714037-139714059 GGGGCCAGCGGGGCACAGAGTGG + Intronic
1033589016 7:142795510-142795532 GGTAATGGTGGGGGGCAGAGAGG - Intergenic
1033839559 7:145357356-145357378 GGGGGTGGTAGGGGAGAGAGAGG + Intergenic
1034336065 7:150324275-150324297 GGGGCTGGAGAGGGACTGGGCGG + Intronic
1034461456 7:151200015-151200037 GAGGCTTGTGGGGGGCAGTGTGG + Intronic
1034491094 7:151393506-151393528 GAGGCTGGTGCTGGACGGAGGGG - Intronic
1034534910 7:151720664-151720686 GGGGATGGAGGGGGATGGAGGGG + Intronic
1034534917 7:151720683-151720705 GGGGATGGATGGGGACAGAGGGG + Intronic
1034940644 7:155228185-155228207 GGGGCTGGAGGCGGCCACAGGGG + Intergenic
1034983109 7:155490935-155490957 GGTGCTGCAGGGGGGCAGAGGGG - Intronic
1035074436 7:156168955-156168977 GGGGGTGGTTGGGGGCAGTGGGG + Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035373595 7:158394118-158394140 GGTGTCCGTGGGGGACAGAGGGG - Intronic
1036391557 8:8328345-8328367 GGGGCTGCTGGGGGCCACTGGGG + Exonic
1037450636 8:19013460-19013482 CGGGATCCTGGGGGACAGAGCGG + Intronic
1038360016 8:26866360-26866382 GGGACTGGCGGGGGACGGGGTGG + Intronic
1039030090 8:33299486-33299508 AGGGCTTGTGGGGCACAGTGAGG + Intergenic
1039085894 8:33779157-33779179 GGGGATGGAGGCAGACAGAGAGG - Intergenic
1039472300 8:37821063-37821085 GAGGGTGGTGGGAGAGAGAGAGG - Intronic
1039607978 8:38898693-38898715 GGGGGTGGGGGGGGACGGTGGGG - Intergenic
1039718074 8:40132542-40132564 GGGGTTGTGGGGGGACAGGGGGG + Intergenic
1039781732 8:40792742-40792764 GGGACTGGAGGGGAAGAGAGGGG + Intronic
1040458880 8:47627687-47627709 GGGGGTGCTGGGGGCCAGGGAGG - Intronic
1040825313 8:51613480-51613502 GGGGCGGGGGGGGGGCAGGGCGG + Intronic
1040850623 8:51898406-51898428 GGGGCTGGGAGGGGACTGAGAGG - Intronic
1041545162 8:59034428-59034450 GGTGGAGGTGGGGGACAGGGTGG - Intronic
1041679749 8:60576811-60576833 AGGGATGGTGGGGGAGAGGGAGG - Intronic
1042059402 8:64800403-64800425 GGGCCTGCTGGAGGGCAGAGTGG + Intergenic
1042310534 8:67374911-67374933 GGGGGTGATGTCGGACAGAGTGG - Intergenic
1042466015 8:69130829-69130851 AGGGCTGGTAGGGGCCAGGGTGG + Intergenic
1042654978 8:71085872-71085894 GGGGCAGGTGGGGGGCATACAGG + Intergenic
1042736153 8:71991914-71991936 GGGGCTGGTAAGTGAGAGAGTGG - Intronic
1042974180 8:74446895-74446917 GGGGCTGGGGGAGGAGAGAGTGG + Intronic
1043377715 8:79668955-79668977 GTGGGTGGTGGGGGACAGTGAGG - Intergenic
1043463898 8:80486707-80486729 GGGGCGGGGGCGAGACAGAGGGG + Exonic
1043482012 8:80663508-80663530 AGGGTTGGTGGGGGGCACAGAGG + Intronic
1043979136 8:86618019-86618041 GGGGGTGATGGGAGACAGTGAGG + Intronic
1044520798 8:93197198-93197220 GAGGCTAGTGGGACACAGAGAGG + Intergenic
1045063340 8:98426556-98426578 GGAGCTGGAGGGGAAAAGAGGGG - Intronic
1046100606 8:109610066-109610088 GTGGCAGGTGGTGGGCAGAGCGG - Intronic
1046154182 8:110265593-110265615 GGGCCTGTTGGGGGAGTGAGGGG + Intergenic
1046818910 8:118615411-118615433 GGGACTGGCAGGGGTCAGAGTGG + Intronic
1047022725 8:120793219-120793241 GGAGAGGGTGGGGGAAAGAGAGG + Intronic
1047190777 8:122677350-122677372 GGGGTTGGTGGGGGAGAAAGGGG + Intergenic
1047239496 8:123073041-123073063 GGGTCTGGTCCGGGACAGCGCGG + Intronic
1047687610 8:127317221-127317243 GGGGCGGCTGGCGGGCAGAGGGG - Intergenic
1047725239 8:127678795-127678817 CGGTCTGGTTGGGGACAGTGGGG - Intergenic
1048047883 8:130790618-130790640 GGTGGTGGTGGGGCACAGACAGG + Intronic
1048372621 8:133792743-133792765 GGGGCTGATCAGAGACAGAGGGG + Intergenic
1048897071 8:139001669-139001691 GTGGCTGCTGAGGCACAGAGAGG + Intergenic
1049171121 8:141161243-141161265 GGGGCTAGTGAGGGACAGACAGG + Intronic
1049206210 8:141364833-141364855 GGGGCTGGTGGGTGACACGCAGG - Intronic
1049283480 8:141762300-141762322 GGGGCTGGGGAGGGTGAGAGGGG + Intergenic
1049319706 8:141989572-141989594 GGGGCTGCTGGCTGAGAGAGGGG - Intergenic
1049440821 8:142608840-142608862 GTGGGTGGTCGGGGGCAGAGGGG - Intergenic
1049551833 8:143263629-143263651 TGGGCTGGTGGGGCAAAGACGGG - Intronic
1049561797 8:143315852-143315874 GGGGCTGGTGCGGGATGGGGAGG - Intronic
1049573450 8:143380046-143380068 GTCGCTGCTGGGGGACAGAGAGG - Exonic
1049575707 8:143388768-143388790 GTGGCTGGAGGGGGACTCAGGGG + Intergenic
1049705555 8:144040476-144040498 GTGGGTGGTGGGTGGCAGAGTGG + Intronic
1049740795 8:144239970-144239992 GGAGCAGGTGGGGGGCAGCGGGG + Intronic
1049769958 8:144375162-144375184 GGGGCTGGGGAGGGACTGAGTGG - Intronic
1050283679 9:4078893-4078915 GGGTGGGGCGGGGGACAGAGGGG - Intronic
1050707205 9:8414902-8414924 GGGGAGGGAGGGGGAGAGAGAGG + Intronic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1052414532 9:28160553-28160575 GGGGCAGGAGGGGAACAGAAAGG - Intronic
1052707032 9:32006635-32006657 GGGCCTGTTGGGGGATAGGGGGG - Intergenic
1052885577 9:33644650-33644672 GGGCCTGTTGGGGGATGGAGTGG + Intergenic
1055023962 9:71699542-71699564 CTGGCTGGTGGGGGACTGGGAGG + Intronic
1055481501 9:76712842-76712864 GGAGCTCTTGGGGGACAGAAAGG + Intronic
1055514554 9:77022223-77022245 GGGAATGGAGGGGGGCAGAGTGG + Intergenic
1055559909 9:77512077-77512099 GGGGACAGTGGGGGACAGTGGGG - Intronic
1055637975 9:78296700-78296722 GGGGCTGGTGGTGGAGAGGTGGG + Intergenic
1056495110 9:87148538-87148560 CCGGCTGGCGGGGGACAGAAGGG - Intergenic
1056800908 9:89690854-89690876 GGGGAGGGGAGGGGACAGAGGGG - Intergenic
1056999851 9:91497480-91497502 GGGGCCTGGGGAGGACAGAGTGG - Intergenic
1057034052 9:91799035-91799057 GGGGCATGTGTGAGACAGAGTGG - Intronic
1057123606 9:92599323-92599345 GGGGCTGGTGTCGGACGGGGAGG - Intronic
1057176602 9:93004776-93004798 CGGGCTGGTGGGACACAGAAGGG - Intronic
1057236545 9:93366087-93366109 GAGGCTGGAGGGGGATGGAGGGG + Intergenic
1057262033 9:93590407-93590429 GGGGCAGGAGTGGGAGAGAGTGG - Intronic
1057294031 9:93825096-93825118 CAGGCAGGTGGGGGGCAGAGAGG - Intergenic
1057426846 9:94958045-94958067 GGGGCTGGGGGAGGAAAGAATGG - Intronic
1057444617 9:95104851-95104873 GGGGCTGGGGAGGGGCAGTGGGG - Intronic
1057557376 9:96098725-96098747 GGGGCTGGTCAGTGACACAGAGG + Intergenic
1057709034 9:97420369-97420391 GGGGCGGGTGGGGGAGGGTGTGG + Intronic
1057718872 9:97516815-97516837 GGGGCTGGGGGAGGAGAGAAAGG + Intronic
1057755491 9:97831776-97831798 GGGAGGGGTGGGAGACAGAGAGG + Intergenic
1058346643 9:103971534-103971556 GGGCCTGGTGGGGGATGGGGGGG - Intergenic
1058619106 9:106864178-106864200 GGTGCTGCTGGTGAACAGAGAGG + Intronic
1058943481 9:109835286-109835308 GGGGAGGGTGGGGGAAAGAGGGG + Intronic
1059264483 9:113013457-113013479 GGGGCTGGTGAGGGAGAAATAGG - Intergenic
1059320036 9:113462286-113462308 GGGGTTGGAGGGGGAGAGTGGGG + Intronic
1059404214 9:114089891-114089913 GAGTCTGGTGGGGGACAGACAGG - Intronic
1059434457 9:114267696-114267718 GGGCCTGGTTAGGGCCAGAGTGG + Intronic
1059769991 9:117415332-117415354 GGGGCTTGGGGGGGCCCGAGGGG - Intergenic
1059865589 9:118510516-118510538 GGGGCCTGTGGGGGGCAGTGGGG + Intergenic
1060247219 9:121957128-121957150 GGGGTTGGGGTGGGAGAGAGTGG - Intronic
1060399644 9:123340723-123340745 GGGGCTGGAGGGGAACAAGGTGG + Intergenic
1060527225 9:124327456-124327478 GGGGCTGCTGGGGCACAGACAGG - Intronic
1060918067 9:127403016-127403038 AGGCCTGGTGGGGGATACAGAGG + Intronic
1060940607 9:127541013-127541035 TGGGGAGGTGGGGGAAAGAGGGG + Intronic
1060953680 9:127622152-127622174 GGGGCTGGGGGAGGGCAGAATGG + Intronic
1061067617 9:128288455-128288477 GGGGCCCGTGGGGGACAGCCTGG + Intronic
1061093153 9:128438535-128438557 GTGGCTGGTTGGGTATAGAGTGG + Intergenic
1061280914 9:129597347-129597369 GGGGCGGGAGGGGGAGAAAGGGG - Intergenic
1061299685 9:129697507-129697529 CGCGCTGGTGGCGGCCAGAGCGG - Intronic
1061498952 9:130991383-130991405 GAGGCCCCTGGGGGACAGAGAGG - Intergenic
1061612364 9:131755664-131755686 GGGGCTGGTGGGTGAGGAAGAGG - Intergenic
1061942509 9:133891304-133891326 GGGGATGGAGGGGGAGACAGAGG + Intronic
1061994260 9:134175859-134175881 GGGGCTGGGGGGGCCCAGGGTGG + Intergenic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1061997207 9:134192602-134192624 GTGGCTGGTGGGGGACACACTGG + Intergenic
1062003533 9:134228466-134228488 GGGGCTGCTGAGGGAGAGAGAGG - Intergenic
1062005442 9:134236425-134236447 GGGGCAGGTTGGGGGCAGGGTGG + Intergenic
1062031921 9:134365638-134365660 GGGACTGGGCGGGGACAGTGGGG + Intronic
1062091138 9:134679417-134679439 GGGGCTGGTTGGGGGCACTGTGG + Intronic
1062091146 9:134679438-134679460 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091197 9:134679587-134679609 GGGGCTGGTTGGGCACTGCGGGG + Intronic
1062091203 9:134679606-134679628 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091218 9:134679649-134679671 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091250 9:134679756-134679778 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062104018 9:134742880-134742902 CGGGCAGGTGGGGGAAGGAGAGG + Intronic
1062307810 9:135919625-135919647 GGGGCCAATGGGGAACAGAGTGG - Intergenic
1062331934 9:136048760-136048782 AGTGCTGGTTGGGGGCAGAGGGG - Intronic
1062367513 9:136218310-136218332 GGGGCTGGGGGGAGAGAGAGAGG - Intronic
1062372601 9:136247757-136247779 GGGGAGGCTGTGGGACAGAGGGG + Intergenic
1062397868 9:136359738-136359760 GGGGGAGCTGGGGCACAGAGGGG + Intronic
1062454456 9:136629111-136629133 GGGGCTGCTGGGGGCCAAGGAGG - Intergenic
1062499311 9:136845488-136845510 GGGGCTCCTCGGGGACATAGCGG - Exonic
1062526986 9:136981907-136981929 GGGGTGGGTGGGAGACAGTGAGG - Intronic
1062527335 9:136983286-136983308 GGGGTGGGTGGGGGACAGTGAGG - Exonic
1062527700 9:136984979-136985001 GGGGCTGGAGGGGCGAAGAGAGG - Exonic
1062547630 9:137070776-137070798 GGGGCTGGGGCGGGGCAGAAAGG - Intergenic
1062600461 9:137316695-137316717 GGGGCTGGGGGACAACAGAGTGG + Intronic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1203773859 EBV:62204-62226 GGAGCTGGTGGAGCACAGTGGGG - Intergenic
1203377121 Un_KI270442v1:385029-385051 GGGGCGGGTTGGGGGCAGAGCGG - Intergenic
1185462639 X:339903-339925 GGAGCTGGGGGGGGTGAGAGGGG + Intronic
1185815608 X:3152257-3152279 GGGGCTGGGGGAGGAAAGAATGG + Intergenic
1185819854 X:3191972-3191994 TGGGCTGGTGGGGGCCAGCATGG + Intergenic
1186482189 X:9904499-9904521 GGGGCTGCTGGGAAACAAAGGGG - Intronic
1186623377 X:11265126-11265148 GGGCTTGGTGGTGGAAAGAGGGG - Intronic
1186806292 X:13143364-13143386 TGGGCGGGTGGGGGAGGGAGAGG + Intergenic
1187360877 X:18626726-18626748 GGGGAGGGGGGGGGAGAGAGGGG - Intronic
1187505376 X:19874708-19874730 GAGGCTGGGGGTGGACAGTGAGG + Intronic
1187670899 X:21664973-21664995 GTGGATGGTGGGGCACAGGGTGG + Intergenic
1188422343 X:30005319-30005341 GGGGTTTGTGGAGGAGAGAGGGG - Intergenic
1189271406 X:39754898-39754920 CAGCATGGTGGGGGACAGAGTGG - Intergenic
1189298680 X:39936816-39936838 GGGTGGGGTGGGGGACAAAGAGG - Intergenic
1189756760 X:44279974-44279996 GGGGCTGGTGGTGGACAGTGTGG - Intronic
1190175911 X:48149176-48149198 GGGTGTGGGGGGGGGCAGAGGGG + Intergenic
1190626516 X:52343083-52343105 GGGGAAGGTGGGGGACAGTGAGG + Intergenic
1190701492 X:52992756-52992778 GGGGAAGGTGGGGGACAGTGAGG - Intronic
1190929278 X:54934421-54934443 GGGGCTTGGGGCTGACAGAGGGG + Intronic
1191025400 X:55908382-55908404 GGGGCTGGTGATTGACAGAATGG + Intergenic
1191101442 X:56733567-56733589 GGAGCTGGTGGGGTGCAGAATGG + Intergenic
1191224308 X:58026079-58026101 GAAGCTGGTGGGGGCCACAGTGG + Intergenic
1192221972 X:69203533-69203555 GGGGCTGGTGGGGAAGTGAGGGG - Intergenic
1192266756 X:69543833-69543855 GGGGCTGGGGTGGGGCACAGAGG + Intergenic
1192315444 X:70047935-70047957 GGGGCAGGTGGGGCAGAGAAGGG - Intronic
1192337912 X:70237321-70237343 GGGGCGGGTGGGGGGAGGAGGGG - Intronic
1192343650 X:70283723-70283745 AGTGCTGGTAGGGGGCAGAGGGG - Intronic
1192359073 X:70426981-70427003 TGGGCTGGTGGGACACCGAGGGG + Exonic
1192584449 X:72308208-72308230 GGGGTGGGGGGGTGACAGAGGGG - Intergenic
1193096699 X:77556407-77556429 GGTGGGGGTGGGGGAGAGAGGGG + Intronic
1195216470 X:102709087-102709109 GGGTGGGGTTGGGGACAGAGAGG + Intergenic
1196351674 X:114738627-114738649 GGGCCTGTTGGGGCATAGAGGGG + Intronic
1196733462 X:118963813-118963835 GGGAGGGGTGGGGGACAGTGTGG + Intergenic
1198042890 X:132871769-132871791 GGGCCTGTTGGGGGAGTGAGGGG + Intronic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1199672163 X:150156191-150156213 GGGGCTGGTGGGGGCAGGGGAGG + Intergenic
1200071313 X:153530808-153530830 GGGGCCGGTGGGGGGCAGAGGGG + Intronic
1200075635 X:153549241-153549263 AGGGCTGGTGGGTAACTGAGAGG + Intronic
1200086936 X:153611592-153611614 GACGCTGGTGGGGCCCAGAGAGG - Intergenic
1200821348 Y:7586715-7586737 CGGGGTGGTGGGGAAGAGAGTGG - Intergenic
1200876439 Y:8160488-8160510 AGGGGTGGTGGGGGACAGAGTGG - Intergenic
1201057194 Y:10006494-10006516 AGGGGTGGTGGGGGAGGGAGTGG + Intergenic
1201140451 Y:11023245-11023267 TGGGCTGGCGGGGGATGGAGTGG - Intergenic
1201867835 Y:18673566-18673588 GGGGGTGGGGGGGGGCAGGGTGG - Intergenic
1202103420 Y:21335297-21335319 GGGGGTAGTGTGGGAGAGAGAGG - Intergenic
1202238956 Y:22746036-22746058 CGGGGTGGTGGGGAAGAGAGTGG + Intergenic