ID: 1124693880

View in Genome Browser
Species Human (GRCh38)
Location 15:31847335-31847357
Sequence ATGAAAAAAGGGTGTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124693877_1124693880 12 Left 1124693877 15:31847300-31847322 CCTGATACTGAGTTGGTTGTGAG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1124693880 15:31847335-31847357 ATGAAAAAAGGGTGTGATCATGG 0: 1
1: 0
2: 1
3: 17
4: 280
1124693875_1124693880 28 Left 1124693875 15:31847284-31847306 CCACTGTGCACACATGCCTGATA 0: 1
1: 0
2: 3
3: 16
4: 165
Right 1124693880 15:31847335-31847357 ATGAAAAAAGGGTGTGATCATGG 0: 1
1: 0
2: 1
3: 17
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124693880 Original CRISPR ATGAAAAAAGGGTGTGATCA TGG Intronic
900915287 1:5633335-5633357 TTGAAAAAAGGGTCGGCTCATGG + Intergenic
901945683 1:12701752-12701774 AAGAAAAAATGGTGTCAGCAGGG - Intergenic
904608604 1:31712862-31712884 ATCAAGAAAGGGTGTGATCCTGG + Intergenic
904700065 1:32352520-32352542 AAAAAAAAAGTGTGTGAGCAGGG - Intronic
904860760 1:33536195-33536217 AGGAAGAATGGGTGTGTTCAAGG - Intronic
906554960 1:46702941-46702963 ATGAAAACATGGTGTGTTCAGGG - Intronic
906958608 1:50398951-50398973 AGCAAAAAAGGGAGTCATCAAGG - Intergenic
907056332 1:51372150-51372172 ATGAAAAAAATGTGTGTGCATGG - Intronic
907603236 1:55790743-55790765 GTGGAAAAAGGGTGAGCTCAGGG - Intergenic
907820084 1:57958729-57958751 ATGAGAAAAGGATGTGATCCAGG + Intronic
908564599 1:65341526-65341548 AAGAAAAAAGGCTGTGACCCTGG + Intronic
909368865 1:74860971-74860993 ATGAAACAACGGTGGAATCAGGG + Intergenic
909540387 1:76784995-76785017 ATGAATAAAGTTTGTGATAAAGG - Intergenic
909676914 1:78249002-78249024 ATTAAAAAATGGAGAGATCACGG + Intergenic
909957149 1:81792311-81792333 ATGCAAACAGTGGGTGATCACGG + Intronic
910515730 1:88057852-88057874 ATGAAAACAGGGTGTGTTTGGGG - Intergenic
911418854 1:97613321-97613343 CTGAACAAAGAGTGTGATAAAGG - Intronic
915212379 1:154320150-154320172 ATGAAATAATTGTGTGATCTTGG + Intergenic
916879252 1:169003551-169003573 ATGAAAAGACTGTGTGTTCAGGG + Intergenic
919674636 1:200369270-200369292 ATGAAGAGAGGATTTGATCACGG + Intergenic
920691170 1:208147433-208147455 ATGAAAAAAAGGGGTTATCCTGG - Intronic
921863635 1:220065228-220065250 AGGCAAAAAGGATGGGATCAAGG + Intronic
922046574 1:221951207-221951229 ATGAAAAAAGGTTGGGAGGAGGG - Intergenic
922081535 1:222302145-222302167 ATGAGCAAAGGGGGTGATGATGG + Intergenic
922435582 1:225602259-225602281 ATTAAAAAAAGGTCTCATCACGG - Intronic
923260419 1:232262976-232262998 AGGAAAAAATGGTATGATGAGGG + Intergenic
924164370 1:241266425-241266447 ATGGAATAAGTGTGTGATCTTGG - Intronic
924466761 1:244305268-244305290 AGGAAATAAGGGTGTGAACCAGG - Intergenic
1064079294 10:12295406-12295428 ATGAAATAATTCTGTGATCATGG + Intergenic
1064881340 10:20057797-20057819 ATGCAAAAAGGATGTCATAAGGG + Intronic
1065044620 10:21736201-21736223 GTGGAAAAAGGGAGTGATCCAGG + Intronic
1065448975 10:25835482-25835504 ATAAAAAAAGTGTGTGATAAAGG - Intergenic
1065481898 10:26203719-26203741 ATGAAAAATGGGAGTAATGATGG + Intronic
1066317348 10:34260999-34261021 ATGCAAAAAGCATGTGATTATGG + Intronic
1071670431 10:87604205-87604227 AGGAAAATTGGGTCTGATCATGG - Intergenic
1072612585 10:97028504-97028526 ATGAAAAAATGGGATGTTCAAGG - Intronic
1074498927 10:114004814-114004836 AAGAAAAAAGAGTGTCTTCAGGG - Intergenic
1075144850 10:119873783-119873805 ATGAAAAAAGGGCATGGTGACGG + Intronic
1075189483 10:120293552-120293574 ATGAAGACAGGGAGAGATCAAGG - Intergenic
1076538702 10:131199736-131199758 CTGAACACAGGGTGTGATGATGG - Intronic
1078801246 11:14645157-14645179 ATGGAAAAAGGGTGTGTTGCGGG + Intronic
1078825560 11:14926927-14926949 ATTAATAGAGGGTTTGATCAAGG + Intronic
1079065394 11:17286649-17286671 ATGAAAGAAGAGGGTGATAAAGG + Intronic
1079504784 11:21141620-21141642 ATGATAAAAGGAGGTGATTAAGG + Intronic
1080112792 11:28587444-28587466 ATAATAAAAAGGTGTGATAATGG + Intergenic
1080928874 11:36786642-36786664 TTGCAAACAGGGTGTAATCATGG - Intergenic
1081408210 11:42722862-42722884 ATGAATAAAGGCAGTGAACATGG - Intergenic
1081767925 11:45624853-45624875 ATGAAAAAAACCTGTGTTCATGG - Intergenic
1082897439 11:58206766-58206788 ATGGAAATAGGATGTGATCTTGG + Intergenic
1083010278 11:59390651-59390673 ATGAAAAAAGAATGAGATTATGG + Intergenic
1083113116 11:60431551-60431573 ATTAACACAGGGTGTGATGAGGG + Intronic
1083145759 11:60757316-60757338 CTGAAAACAGGATGTGAGCAAGG + Intronic
1086229579 11:84552206-84552228 AAGAAACAAGGGTGTGATGGGGG - Intronic
1086461357 11:87008833-87008855 ATTAAAAAAGAGTAAGATCAGGG - Intergenic
1087713418 11:101581497-101581519 ATGAAAAAAGGTTTTGTTCATGG + Intronic
1087715971 11:101609216-101609238 ATGCAGGATGGGTGTGATCAGGG + Intronic
1090126068 11:124085950-124085972 AGGACATCAGGGTGTGATCAAGG + Intergenic
1091060053 11:132452636-132452658 ATGAAAAAAGGAGGTGAAGAAGG - Intronic
1092450853 12:8600732-8600754 TAGAAAAAAGGATATGATCAAGG + Intergenic
1093474492 12:19539621-19539643 ATGAAAAATGGGAGTGACCATGG + Intronic
1094824553 12:34259734-34259756 ATGAAAATAGAATGTTATCATGG + Intergenic
1095086652 12:38063527-38063549 ATGAAAATAGAATGTTATCATGG - Intergenic
1095256808 12:40047195-40047217 AAGAAAAAAGGGTGTGGACTGGG - Intronic
1097432174 12:59523879-59523901 ATGAAGAAAAGGTGAGAACATGG + Exonic
1097534289 12:60846883-60846905 AAGACAAAAAGGTGTGATCTGGG + Intergenic
1098544014 12:71691025-71691047 ATGAAATAAGGGGGAGATCCAGG - Intronic
1100567050 12:95806577-95806599 ATGGCAGAAGGGTGTGAACAGGG - Intronic
1100660049 12:96686951-96686973 ATAAAATAAGTGTGTCATCAGGG + Intronic
1100668058 12:96777277-96777299 ATGAAAAAAGTGTGTGCTCAAGG + Intronic
1101432213 12:104636071-104636093 CTGTAAAATGGGGGTGATCATGG - Intronic
1106085276 13:26536150-26536172 ATGGAAAAGAGGTGTGTTCAGGG + Intergenic
1107365939 13:39675642-39675664 ATGATTAAGGGGTATGATCAAGG + Intronic
1108665527 13:52626068-52626090 ATGAAAAAAGGGGTTCAGCATGG - Intergenic
1108752581 13:53463515-53463537 ATGCGAAAAGGGTTTCATCAAGG + Intergenic
1110151545 13:72260712-72260734 AAGAATATAGGGTGTGATTATGG + Intergenic
1110957050 13:81566716-81566738 ATTAAAATAGGGTTTTATCAAGG + Intergenic
1111346402 13:86960628-86960650 ATGAAAAAAATGTGTGATTTGGG - Intergenic
1111674180 13:91366761-91366783 TGGAATAAGGGGTGTGATCATGG + Intergenic
1112174325 13:97006864-97006886 AAGAAAAAAGCATGGGATCAAGG - Intergenic
1113715271 13:112501105-112501127 ATGATAGAAGGATGTGATCAGGG + Intronic
1116290797 14:43036770-43036792 AATAAAAAAGTGTGTGCTCATGG - Intergenic
1118362554 14:65068812-65068834 ATGGAAAGACTGTGTGATCAAGG - Intronic
1119073909 14:71616526-71616548 ATAAAAAAAGAGGGTCATCAAGG + Intronic
1121789893 14:96691043-96691065 ATGAAACAATGGTGGAATCAGGG + Intergenic
1122346633 14:101065003-101065025 ATGAAAAGCGGGTGCGAGCAGGG + Intergenic
1123829163 15:24116264-24116286 ATGAAAAAAGTTTATAATCATGG + Intergenic
1123859166 15:24445993-24446015 ATGAAAAAAGTTTATAATCATGG + Intergenic
1124693880 15:31847335-31847357 ATGAAAAAAGGGTGTGATCATGG + Intronic
1125641541 15:41235117-41235139 TTGAAAAAAAGGTGTAATCGGGG + Intronic
1126222561 15:46231156-46231178 AGGAAAAACGGGTATGAGCAGGG + Intergenic
1131074983 15:89489840-89489862 AAGAAAAAAGGGTGCCATAAGGG - Intronic
1131315919 15:91337341-91337363 ATGAAAAAAGAGTCAAATCATGG - Intergenic
1131635275 15:94226811-94226833 ATGAAAAAAGGGAGTCTTCATGG - Intergenic
1131787865 15:95932452-95932474 AGGAAACAAGGGTGTTAACAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133486611 16:6225687-6225709 AAGACAAAAGAGTGTGAGCAGGG - Intronic
1134842914 16:17415838-17415860 TTGAATAAAGGGTGTAATCATGG + Intronic
1135604263 16:23809510-23809532 ATGAAACCAAGGAGTGATCACGG - Intergenic
1135730109 16:24887315-24887337 CTGAAAAAATTGTGTGGTCAAGG + Intronic
1138442391 16:57042834-57042856 ACAAAAACAGGGTGTGAGCAGGG - Intronic
1138676788 16:58657146-58657168 AAGAAAAAAGGGTGATATAAGGG - Intergenic
1139272728 16:65698903-65698925 GTGAAAAAAGAGTGGGAGCAGGG - Intergenic
1139434170 16:66926544-66926566 ATAAACACAGGGTGTGGTCAAGG + Intergenic
1142107888 16:88315984-88316006 CTGAGGAAAGGCTGTGATCACGG + Intergenic
1144291421 17:13830327-13830349 ATCCAACAAGGGTGTAATCAAGG - Intergenic
1144441576 17:15287320-15287342 ATGGAAAAAGGGAGGGCTCAGGG - Intergenic
1146667443 17:34714635-34714657 ATGAAAAAGGGGTGGAAGCAAGG - Intergenic
1148852890 17:50563220-50563242 ATGAGAAGAGGATGTGATGAGGG - Intronic
1149427356 17:56568313-56568335 ATAAAAAATGTGTGTGCTCATGG - Intergenic
1149903588 17:60504956-60504978 ATGAAAAGGGGTTGTTATCAAGG + Intronic
1149910779 17:60564952-60564974 CTGAAAAAAAGCTGTGACCAAGG - Intronic
1150145347 17:62764521-62764543 ATTATAAAGGAGTGTGATCAAGG + Intronic
1150927668 17:69550700-69550722 AGGGAAAAAGAGTGTGATGAAGG + Intergenic
1151208690 17:72527696-72527718 AAGAAAAAAAAGTGTGAGCAAGG + Intergenic
1151416867 17:73972354-73972376 GTGCAGAAAGGGTGTGGTCAGGG - Intergenic
1153801920 18:8678718-8678740 ATGAAAGAACAGTGTGAGCAGGG - Intergenic
1153882538 18:9433952-9433974 ATGGAAAGAAGGTGTGATGAAGG - Intergenic
1154357157 18:13630407-13630429 ATGAAAAAAGGGAGAAAACAGGG + Intronic
1155910613 18:31500359-31500381 CTGAAAAACTGCTGTGATCAGGG + Intronic
1157808972 18:50679705-50679727 ATGAGAAGAGGGAGTAATCATGG + Intronic
1158318257 18:56235857-56235879 ATGAAAAAAGGGTCTCAGGAAGG - Intergenic
1159832242 18:73291293-73291315 ATGAAAGAAATGTGTGTTCATGG + Intergenic
1160075556 18:75671921-75671943 ATGAAAAAAAAATGTGAGCAAGG - Intergenic
1161617329 19:5278898-5278920 ATGAAAAAAGGGGTTGGGCATGG + Intronic
1164529662 19:29038756-29038778 ATGAAAAGAAGTTGTTATCAGGG + Intergenic
1164968671 19:32510704-32510726 CTTAAAGACGGGTGTGATCAGGG + Intergenic
1168221390 19:54963042-54963064 GTGAAAAATGGGTAGGATCATGG + Intronic
925948091 2:8885087-8885109 GTGAAAAAATGGTATGTTCAGGG - Intronic
927460540 2:23294690-23294712 TTGAAAAAAAGGTGGGATCCTGG - Intergenic
928545923 2:32329154-32329176 ATGAAAGGAGGGAGTGATAATGG - Intergenic
929807713 2:45161813-45161835 ATGGAAAATGAATGTGATCAAGG - Intergenic
931097572 2:58958474-58958496 ATGGACACAGGGTGGGATCATGG + Intergenic
931292346 2:60884459-60884481 ATGTCAAAAGACTGTGATCAAGG - Intronic
931467292 2:62501743-62501765 AAGAAATAAGGGAGTGATTAGGG + Intronic
932074178 2:68647624-68647646 CTGAAAAAAGGGGGTTACCAAGG + Intronic
933563056 2:83913256-83913278 ATGAAAAAGCGGTGTGATGCGGG + Intergenic
933782487 2:85811934-85811956 CTGTAAAATGGGCGTGATCATGG + Intergenic
934593363 2:95579285-95579307 ATGAAAAACGGATTTGATGAAGG - Intergenic
935638096 2:105265937-105265959 ATGAAGAGAGGGTGTATTCAGGG + Exonic
937842390 2:126536756-126536778 ATGAGAAGGGGGTGTGTTCATGG - Intergenic
939268417 2:139906243-139906265 AAAAAAAAAGGATGTGTTCAGGG - Intergenic
939565320 2:143780515-143780537 AGGAAAAAAGGAAGTCATCAAGG + Intergenic
939608652 2:144283076-144283098 ATTAAAAAAGGATATGATAAAGG - Intronic
939761318 2:146184185-146184207 TTGAAAAAAGGTAGTGATAATGG + Intergenic
939857643 2:147379251-147379273 ATGAGAGCAGGGTGTGTTCAAGG - Intergenic
940999669 2:160188503-160188525 ACAAAAACAGGGTGTGATTAGGG - Intronic
942970358 2:181950777-181950799 ATGAAAAAATGGTGTGTTACTGG + Intergenic
944203470 2:197133296-197133318 ATGTAAAATGGGGGAGATCAAGG - Intronic
945587650 2:211686916-211686938 ATGAAAAACAGGAATGATCATGG + Intronic
946261865 2:218499661-218499683 ATGAAAACAGCATGTGATCCTGG - Intronic
947447326 2:230174017-230174039 CTGAAAGAAGGGTGTCTTCAGGG - Intronic
948324823 2:237106377-237106399 ATGATAAATGTGTGTGATGATGG + Intergenic
1169656557 20:7930605-7930627 AATAAAAGAGGGTGTGTTCATGG + Intronic
1169778508 20:9283061-9283083 ATTACAAAGGAGTGTGATCAAGG + Intronic
1170728163 20:18948264-18948286 TAGGAAAAAGGGAGTGATCAAGG + Intergenic
1172433707 20:34913676-34913698 ATGAAGAAAGGGGTTGCTCATGG - Intronic
1173357817 20:42311156-42311178 ATGAAAACACGATGAGATCAGGG + Intronic
1175479254 20:59300207-59300229 ATGAGAAAAGGCTGTGCTCAAGG - Intergenic
1175631168 20:60537521-60537543 ATGAAAAAAGGGGGCGGGCATGG + Intergenic
1176136557 20:63525000-63525022 AGGATGGAAGGGTGTGATCAAGG + Intergenic
1177852024 21:26359901-26359923 ATGAAGAAAAGGTGTGGTCAAGG + Intergenic
1178292969 21:31385424-31385446 ACGAAAGAAGGGTGGGGTCAAGG + Intronic
1179249304 21:39659579-39659601 CTGTAAAATGGGTATGATCAAGG - Intronic
1180035745 21:45247850-45247872 TTGAAAAAAGGTTGTGTTCAAGG + Intergenic
1181601520 22:23955015-23955037 ATGAAGATGGGGTGTGTTCAGGG - Intergenic
1181604167 22:23970092-23970114 ATGAAGATGGGGTGTGTTCAGGG + Intronic
1181606984 22:23986286-23986308 ATGAAGATGGGGTGTGTTCAGGG + Intergenic
1183161228 22:36114649-36114671 ATGAAGAAGGGGTGTGGTCTTGG + Intergenic
1183878441 22:40804731-40804753 GTGAGAAAAGGGTGGGATTATGG + Intronic
1185390259 22:50556691-50556713 ATGAAAAAAGTCTGTCATAATGG + Intronic
949711659 3:6877399-6877421 ATGAAAAGTGGGTATGTTCATGG + Intronic
950319625 3:12038538-12038560 ATGAAAAAAATCTGTGTTCATGG - Intronic
951361796 3:21734013-21734035 ATGAAAAAAGAGTGTTCTGACGG - Intronic
951706910 3:25552701-25552723 ATGAACCAAGGGTATGATAAAGG + Intronic
952187233 3:30983132-30983154 CTGAAAAATGGGTATGATCTTGG + Intergenic
955764850 3:62332075-62332097 ATAAAACAAGGCAGTGATCAAGG + Intronic
957342489 3:78918849-78918871 ATGAAAAAAGGATATGAAAAAGG + Intronic
957562300 3:81838106-81838128 ATGGAATAAGGGAGTTATCATGG - Intergenic
957938960 3:86980115-86980137 AAAAAAAAAAGGTATGATCAAGG - Intronic
958982761 3:100743008-100743030 ATCAAAAAAGGCTGAGATTAAGG - Intronic
960103147 3:113766008-113766030 ATGAAAAAAAGGTGACATAATGG - Intronic
960329771 3:116344395-116344417 ATGGAAGAAGGGGGTGATGAGGG + Intronic
960680453 3:120242479-120242501 ATGAGATGAGGGGGTGATCATGG + Intronic
961117249 3:124341083-124341105 AGGAAGAAAGGGGGTGATTAGGG + Intronic
961497936 3:127307622-127307644 ATGAAAAGAGGATGTGAAAATGG - Intergenic
962845974 3:139274190-139274212 ATTACAAAAGAGTGTGATGAGGG - Intronic
963123462 3:141795010-141795032 GTGATAATACGGTGTGATCAGGG + Intronic
963373471 3:144433095-144433117 AAGAATAAAAGGTGTGATAAAGG - Intergenic
964199905 3:154107481-154107503 ATGCACAAAGGGTATGAACAAGG + Intergenic
966127652 3:176598681-176598703 AAGACAAAAGGTTGTGATCCTGG + Intergenic
967069936 3:185953716-185953738 ATGTAAAATGGGTGTAATAATGG - Intergenic
967426932 3:189338105-189338127 AAGAAAGAAGGGTGGGAGCATGG + Intergenic
967811317 3:193763370-193763392 AGGAAAAGATGGTGTGATGATGG - Intergenic
968630960 4:1651164-1651186 ATGGAACAATGGTGTGATCTTGG - Intronic
969129053 4:4977602-4977624 AAGGAGAAAGGGTGTGTTCAGGG - Intergenic
970027466 4:11638897-11638919 AAAAAAAAAGGGTTTCATCAGGG - Intergenic
970458851 4:16252860-16252882 TTGAAGGAAGGATGTGATCATGG - Intergenic
970535251 4:17023807-17023829 ATCAAAAATGGGGGTGATCTTGG - Intergenic
972832265 4:42827909-42827931 ATGAAAAAATAATGTGTTCAGGG + Intergenic
973607048 4:52598437-52598459 AGGGAGAAGGGGTGTGATCATGG - Intronic
974102090 4:57428719-57428741 ATGAAATGAGGGTGACATCAGGG - Intergenic
974160977 4:58138736-58138758 ATGAATAAAGTGGTTGATCATGG + Intergenic
974383964 4:61180705-61180727 ATCTCAAAAGGGTGTGATAATGG - Intergenic
974589692 4:63928873-63928895 ATGAAAGAAGTGAGTGTTCAAGG - Intergenic
974688355 4:65262710-65262732 ATGAGAAAAGGGAGAAATCAAGG + Intergenic
974697285 4:65392207-65392229 AAGAAAAAAGCATGTAATCATGG + Intronic
975176951 4:71300046-71300068 ATGAAAAATGGGTTTGATTAAGG - Intronic
979568942 4:122192989-122193011 ATGAGAGAAGGATGTGATCTAGG + Intronic
981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG + Intergenic
982379509 4:154734387-154734409 ATGGAAAAAGTGTGGGATGATGG - Intronic
983277212 4:165632486-165632508 ATGAATAAATGTTGTAATCAAGG - Intergenic
983870033 4:172814575-172814597 AAGAAAAATGTCTGTGATCAAGG + Intronic
986352045 5:6889396-6889418 GTGAAAAAAGGGGGTGATTGAGG + Intergenic
987964314 5:24852179-24852201 TTGCAAAAAGAGTGTGCTCAAGG - Intergenic
990268594 5:54107944-54107966 AGGAAAAAACAGTGAGATCAAGG + Intronic
990282068 5:54261769-54261791 CCGAAAAAACGGTGTGGTCATGG - Intronic
992543909 5:77791796-77791818 AGGCCAAAAGGGTATGATCAAGG + Intronic
993739606 5:91521950-91521972 GAGAAAGAAGGGTGTGATCGGGG + Intergenic
993826580 5:92695094-92695116 ATGTAAAAATTGTGTGAACAAGG + Intergenic
995537819 5:113154858-113154880 ATGAAAAATGTTTGTGATGATGG - Intronic
999838719 5:155401676-155401698 AAAAAAAAAGGGTGAGAACAGGG - Intergenic
1002383181 5:178845239-178845261 AAGAAAAAAGGGTGTGACGGAGG - Intergenic
1003681277 6:8259476-8259498 TTGAATAAATGGGGTGATCAAGG + Intergenic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1005582074 6:27245054-27245076 ATGGAAAAAGGGTTTGAACAGGG - Intergenic
1005967645 6:30739129-30739151 ATTAAAAAAGGGTATGAAGAAGG - Intronic
1008355265 6:50545331-50545353 ATGTAATAATTGTGTGATCAAGG - Intergenic
1009981527 6:70731536-70731558 AAGGAAAGAGGATGTGATCAGGG - Intronic
1011472273 6:87719610-87719632 CTGGAGAAAGGATGTGATCAAGG + Intergenic
1012345573 6:98181226-98181248 ATAAAAAAAGAATGAGATCATGG + Intergenic
1013328100 6:109068529-109068551 ATGAAAAAAGGTTAAGATGAAGG + Intronic
1014756237 6:125304207-125304229 ATTAAAAAATGGAGGGATCAAGG + Intergenic
1016239537 6:141913391-141913413 GTGAGAAAAGGGTTTAATCAAGG - Intergenic
1017033081 6:150241350-150241372 ATTAATAAAGGATGTGATAAAGG - Intronic
1017703450 6:157097792-157097814 AAGAAAAAAAGCTGTGAACAGGG - Intronic
1017830511 6:158123923-158123945 ATGAAAGAAGGATGTGCTCAGGG + Intronic
1021395320 7:20140370-20140392 ATGAAAAATGGGGGTGATGCTGG + Exonic
1024118141 7:46212065-46212087 ATGTGGAAAGGTTGTGATCAAGG - Intergenic
1024968292 7:55044905-55044927 AAGAAAGAAGGCTGTGTTCATGG + Intronic
1025996726 7:66531890-66531912 AAAAAAAAAGGGTGTCAGCAGGG + Intergenic
1026620242 7:71943879-71943901 ATGAAAATGGGGAGTGAGCATGG + Intronic
1027135182 7:75618838-75618860 AAAAAAAAAGGATGTGCTCAAGG - Intronic
1027557221 7:79680427-79680449 ATAAAAAAAGTGTTTGAACAAGG - Intergenic
1027919906 7:84379632-84379654 ATGAAATAAGGGGGTGATTTAGG - Intronic
1027983838 7:85259792-85259814 GTGAGAAAAGGGAGTGTTCAAGG + Intergenic
1028460658 7:91088203-91088225 ATGAATAAAGGCTGGGAGCATGG + Intronic
1029678240 7:102087988-102088010 AAAAAAAAAGGGTGAGATTAAGG - Intronic
1034006255 7:147475481-147475503 ATGAGTAAAGGGTTTGAACAGGG - Intronic
1034492660 7:151402263-151402285 ATGAAAGCAGGGTGTCAGCAGGG - Intronic
1034960653 7:155362337-155362359 TTGAAAAAAACATGTGATCAGGG - Intronic
1035829733 8:2682028-2682050 ATAATAAAAAGGTGTGTTCAAGG - Intergenic
1037441619 8:18922180-18922202 ATGAAAAAACGGTTTGTTCAGGG + Intronic
1038158208 8:25011124-25011146 AAGAAAAAGGGGTGGGGTCAGGG + Intergenic
1039250532 8:35659396-35659418 ATGACAAAACAATGTGATCATGG + Intronic
1039544628 8:38400458-38400480 ATGAAAAACGCATGTCATCATGG + Intronic
1039701219 8:39963721-39963743 ATGAAAACAGAATGTGATGAGGG - Intronic
1040553351 8:48456644-48456666 AAAAAAAAAAGGTGTAATCATGG + Intergenic
1041331717 8:56733719-56733741 AAGAAAAAAGGGCATGAACAAGG - Intergenic
1041819998 8:62020384-62020406 ATGAAAATAGGATGAGATAAAGG - Intergenic
1042095695 8:65213675-65213697 ATGAAGAGAGTGTGTTATCAAGG - Intergenic
1043494236 8:80782681-80782703 CTGAAAAAAGGGTTTCATTAAGG + Intronic
1043496973 8:80812207-80812229 TTCAAAAAAGGGAGTCATCAAGG - Intronic
1044262428 8:90142123-90142145 ATGAAAAGAGGGTGAGAGGAAGG + Intergenic
1044406385 8:91831477-91831499 ACAAACAAAGAGTGTGATCAGGG + Intergenic
1044880022 8:96714111-96714133 CTGAAAAAAGGGCATGACCAAGG - Intronic
1047281644 8:123451135-123451157 AGAAAAAAAGGGTCAGATCAGGG - Intronic
1047594459 8:126364353-126364375 ATAATAAAAGGCTGTCATCATGG + Intergenic
1048548765 8:135414074-135414096 ATGAAAACAAATTGTGATCAGGG + Intergenic
1048711220 8:137213199-137213221 ATAATAAAAGGGTGTGATTTTGG - Intergenic
1049681838 8:143922400-143922422 AGAAGAAGAGGGTGTGATCAGGG + Intronic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050833392 9:10043638-10043660 ATGCAAAAAAGGTGAGATGATGG + Intronic
1051326105 9:15970796-15970818 ATCAAAACAGGGTGGTATCATGG + Intronic
1053330343 9:37200203-37200225 ATAAAAAAAGGAAGTGAACATGG - Intronic
1055248185 9:74272444-74272466 CTGTAAAAAGGGTATGATAATGG - Intergenic
1056478916 9:86981202-86981224 ATGAAAAGAAGTTCTGATCAAGG + Intergenic
1057695438 9:97319651-97319673 ATAAAAAAAGAATGAGATCATGG - Intronic
1057919136 9:99082308-99082330 GTGGAAAAAGGGTATGATCTGGG + Intergenic
1058832469 9:108831511-108831533 AAGAAAGAATGGTGAGATCAAGG + Intergenic
1059578359 9:115516857-115516879 AGGAGAATGGGGTGTGATCAGGG - Intergenic
1060864106 9:126981276-126981298 ATGCACAGAGGGTGTGGTCAAGG + Intronic
1185908985 X:3965264-3965286 ATGAAAAAAGACTGTAACCAGGG - Intergenic
1186150114 X:6665744-6665766 CTGAGAAAAAGGTGTGATGATGG - Intergenic
1187409239 X:19034385-19034407 ATGGAAAGAGGCTGTGTTCAGGG + Intronic
1188127211 X:26383929-26383951 ATGTAAAAAGGATGAGATCTGGG + Intergenic
1193973094 X:88082076-88082098 ATGAAAAAAGGATCAGATCCAGG - Intergenic
1194745223 X:97620803-97620825 ATGAAAGAAGAGGGTGATCCAGG - Intergenic
1194814184 X:98422732-98422754 AGCAAAAAAGGGAGTCATCAAGG + Intergenic
1195138658 X:101935882-101935904 AGGAAACAAGGGTGGGATTAGGG + Intergenic
1195735576 X:108009433-108009455 AGGAAGAAAGGATGTGAACAGGG + Intergenic
1196158307 X:112455009-112455031 ATCAAAAAAGAGTTTGATCTGGG - Exonic
1196235914 X:113279456-113279478 GTGAAAAAAGGAGGTAATCACGG + Intergenic
1196387786 X:115177113-115177135 ATGGTACAATGGTGTGATCAGGG + Intronic
1197703719 X:129618688-129618710 CTGTTAAAAGGGTGTGATAATGG + Intergenic
1198800421 X:140442225-140442247 GTGTAAAAAGGGAGTGGTCAGGG + Intergenic
1198950468 X:142065347-142065369 AGGAAAAAGGGGAGTGAACAAGG + Intergenic
1199705876 X:150424543-150424565 AGGAAAAAAGGGTGTGTTGATGG + Intronic
1201773204 Y:17638637-17638659 ATGAAAATAGAATGTTATCATGG + Intergenic
1201828351 Y:18267349-18267371 ATGAAAATAGAATGTTATCATGG - Intergenic