ID: 1124696660

View in Genome Browser
Species Human (GRCh38)
Location 15:31869996-31870018
Sequence CTGCGTGGGTCCCCGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696660_1124696670 15 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86
1124696660_1124696666 3 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696666 15:31870022-31870044 CAGCTCCGGTGCCCGGCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 111
1124696660_1124696676 27 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696676 15:31870046-31870068 CTCGCGCGCGGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 27
4: 200
1124696660_1124696673 22 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696673 15:31870041-31870063 GCGGCCTCGCGCGCGGCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 140
1124696660_1124696671 20 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696671 15:31870039-31870061 GAGCGGCCTCGCGCGCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 78
1124696660_1124696675 26 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696675 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 165
1124696660_1124696665 -4 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696665 15:31870015-31870037 GCAGTCACAGCTCCGGTGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 185
1124696660_1124696672 21 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696660 Original CRISPR CTGCGTGGGTCCCCGCGGCC CGG (reversed) Intronic