ID: 1124696661

View in Genome Browser
Species Human (GRCh38)
Location 15:31870001-31870023
Sequence TGTGACTGCGTGGGTCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696661_1124696676 22 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696676 15:31870046-31870068 CTCGCGCGCGGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 27
4: 200
1124696661_1124696673 17 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696673 15:31870041-31870063 GCGGCCTCGCGCGCGGCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 140
1124696661_1124696665 -9 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696665 15:31870015-31870037 GCAGTCACAGCTCCGGTGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 185
1124696661_1124696670 10 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86
1124696661_1124696671 15 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696671 15:31870039-31870061 GAGCGGCCTCGCGCGCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 78
1124696661_1124696672 16 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696661_1124696675 21 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696675 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 165
1124696661_1124696666 -2 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696666 15:31870022-31870044 CAGCTCCGGTGCCCGGCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696661 Original CRISPR TGTGACTGCGTGGGTCCCCG CGG (reversed) Intronic