ID: 1124696664

View in Genome Browser
Species Human (GRCh38)
Location 15:31870011-31870033
Sequence GCACCGGAGCTGTGACTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696664_1124696675 11 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696675 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 165
1124696664_1124696672 6 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696664_1124696677 22 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478
1124696664_1124696676 12 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696676 15:31870046-31870068 CTCGCGCGCGGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 27
4: 200
1124696664_1124696670 0 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86
1124696664_1124696671 5 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696671 15:31870039-31870061 GAGCGGCCTCGCGCGCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 78
1124696664_1124696673 7 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696673 15:31870041-31870063 GCGGCCTCGCGCGCGGCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696664 Original CRISPR GCACCGGAGCTGTGACTGCG TGG (reversed) Intronic