ID: 1124696665

View in Genome Browser
Species Human (GRCh38)
Location 15:31870015-31870037
Sequence GCAGTCACAGCTCCGGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696652_1124696665 25 Left 1124696652 15:31869967-31869989 CCCAGCAGAGCGAGCGGGACGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1124696665 15:31870015-31870037 GCAGTCACAGCTCCGGTGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 185
1124696660_1124696665 -4 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696665 15:31870015-31870037 GCAGTCACAGCTCCGGTGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 185
1124696653_1124696665 24 Left 1124696653 15:31869968-31869990 CCAGCAGAGCGAGCGGGACGGCG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1124696665 15:31870015-31870037 GCAGTCACAGCTCCGGTGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 185
1124696661_1124696665 -9 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696665 15:31870015-31870037 GCAGTCACAGCTCCGGTGCCCGG 0: 1
1: 0
2: 2
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696665 Original CRISPR GCAGTCACAGCTCCGGTGCC CGG Intronic