ID: 1124696666

View in Genome Browser
Species Human (GRCh38)
Location 15:31870022-31870044
Sequence CAGCTCCGGTGCCCGGCGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696660_1124696666 3 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696666 15:31870022-31870044 CAGCTCCGGTGCCCGGCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 111
1124696661_1124696666 -2 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696666 15:31870022-31870044 CAGCTCCGGTGCCCGGCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696666 Original CRISPR CAGCTCCGGTGCCCGGCGAG CGG Intronic