ID: 1124696667

View in Genome Browser
Species Human (GRCh38)
Location 15:31870027-31870049
Sequence CGAGGCCGCTCGCCGGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2258
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 2231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696667_1124696677 6 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478
1124696667_1124696683 25 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696683 15:31870075-31870097 CCGGCCGTCTGCAAGAGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 60
1124696667_1124696673 -9 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696673 15:31870041-31870063 GCGGCCTCGCGCGCGGCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 140
1124696667_1124696676 -4 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696676 15:31870046-31870068 CTCGCGCGCGGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 27
4: 200
1124696667_1124696675 -5 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696675 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 165
1124696667_1124696672 -10 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696667_1124696684 26 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696684 15:31870076-31870098 CGGCCGTCTGCAAGAGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696667 Original CRISPR CGAGGCCGCTCGCCGGGCAC CGG (reversed) Intronic