ID: 1124696670

View in Genome Browser
Species Human (GRCh38)
Location 15:31870034-31870056
Sequence CCGGCGAGCGGCCTCGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696661_1124696670 10 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86
1124696664_1124696670 0 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86
1124696663_1124696670 1 Left 1124696663 15:31870010-31870032 CCCACGCAGTCACAGCTCCGGTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86
1124696660_1124696670 15 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696670 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696670 Original CRISPR CCGGCGAGCGGCCTCGCGCG CGG Intronic