ID: 1124696672

View in Genome Browser
Species Human (GRCh38)
Location 15:31870040-31870062
Sequence AGCGGCCTCGCGCGCGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696667_1124696672 -10 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696663_1124696672 7 Left 1124696663 15:31870010-31870032 CCCACGCAGTCACAGCTCCGGTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696660_1124696672 21 Left 1124696660 15:31869996-31870018 CCGGGCCGCGGGGACCCACGCAG 0: 1
1: 0
2: 2
3: 7
4: 200
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696661_1124696672 16 Left 1124696661 15:31870001-31870023 CCGCGGGGACCCACGCAGTCACA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1124696664_1124696672 6 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696672 15:31870040-31870062 AGCGGCCTCGCGCGCGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696672 Original CRISPR AGCGGCCTCGCGCGCGGCTC GGG Intronic