ID: 1124696677

View in Genome Browser
Species Human (GRCh38)
Location 15:31870056-31870078
Sequence GCTCGGGGCCGGGCCCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 478}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696668_1124696677 0 Left 1124696668 15:31870033-31870055 CCCGGCGAGCGGCCTCGCGCGCG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478
1124696664_1124696677 22 Left 1124696664 15:31870011-31870033 CCACGCAGTCACAGCTCCGGTGC 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478
1124696669_1124696677 -1 Left 1124696669 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478
1124696667_1124696677 6 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478
1124696663_1124696677 23 Left 1124696663 15:31870010-31870032 CCCACGCAGTCACAGCTCCGGTG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1124696677 15:31870056-31870078 GCTCGGGGCCGGGCCCTGCCCGG 0: 1
1: 0
2: 7
3: 47
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696677 Original CRISPR GCTCGGGGCCGGGCCCTGCC CGG Intronic