ID: 1124696683

View in Genome Browser
Species Human (GRCh38)
Location 15:31870075-31870097
Sequence CCGGCCGTCTGCAAGAGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696668_1124696683 19 Left 1124696668 15:31870033-31870055 CCCGGCGAGCGGCCTCGCGCGCG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1124696683 15:31870075-31870097 CCGGCCGTCTGCAAGAGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 60
1124696669_1124696683 18 Left 1124696669 15:31870034-31870056 CCGGCGAGCGGCCTCGCGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1124696683 15:31870075-31870097 CCGGCCGTCTGCAAGAGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 60
1124696667_1124696683 25 Left 1124696667 15:31870027-31870049 CCGGTGCCCGGCGAGCGGCCTCG 0: 1
1: 0
2: 0
3: 26
4: 2231
Right 1124696683 15:31870075-31870097 CCGGCCGTCTGCAAGAGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 60
1124696674_1124696683 7 Left 1124696674 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG 0: 1
1: 0
2: 2
3: 29
4: 255
Right 1124696683 15:31870075-31870097 CCGGCCGTCTGCAAGAGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696683 Original CRISPR CCGGCCGTCTGCAAGAGCCG CGG Intronic