ID: 1124696894

View in Genome Browser
Species Human (GRCh38)
Location 15:31870818-31870840
Sequence GCGCACGTCCGCGCGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124696894_1124696908 17 Left 1124696894 15:31870818-31870840 CCCCGCCCCGCGCGGACGTGCGC No data
Right 1124696908 15:31870858-31870880 CGCCCCCGCCCCTCCGGGGCCGG No data
1124696894_1124696914 23 Left 1124696894 15:31870818-31870840 CCCCGCCCCGCGCGGACGTGCGC No data
Right 1124696914 15:31870864-31870886 CGCCCCTCCGGGGCCGGGCACGG No data
1124696894_1124696903 12 Left 1124696894 15:31870818-31870840 CCCCGCCCCGCGCGGACGTGCGC No data
Right 1124696903 15:31870853-31870875 TGCCCCGCCCCCGCCCCTCCGGG No data
1124696894_1124696904 13 Left 1124696894 15:31870818-31870840 CCCCGCCCCGCGCGGACGTGCGC No data
Right 1124696904 15:31870854-31870876 GCCCCGCCCCCGCCCCTCCGGGG No data
1124696894_1124696902 11 Left 1124696894 15:31870818-31870840 CCCCGCCCCGCGCGGACGTGCGC No data
Right 1124696902 15:31870852-31870874 GTGCCCCGCCCCCGCCCCTCCGG No data
1124696894_1124696909 18 Left 1124696894 15:31870818-31870840 CCCCGCCCCGCGCGGACGTGCGC No data
Right 1124696909 15:31870859-31870881 GCCCCCGCCCCTCCGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124696894 Original CRISPR GCGCACGTCCGCGCGGGGCG GGG (reversed) Intergenic
No off target data available for this crispr