ID: 1124701604

View in Genome Browser
Species Human (GRCh38)
Location 15:31918196-31918218
Sequence CTCAGTTCTCTGATGGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124701595_1124701604 30 Left 1124701595 15:31918143-31918165 CCCCTGGTAGCCTGTGTCTCTGT No data
Right 1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG No data
1124701598_1124701604 20 Left 1124701598 15:31918153-31918175 CCTGTGTCTCTGTACATTTTAGT No data
Right 1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG No data
1124701597_1124701604 28 Left 1124701597 15:31918145-31918167 CCTGGTAGCCTGTGTCTCTGTAC No data
Right 1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG No data
1124701596_1124701604 29 Left 1124701596 15:31918144-31918166 CCCTGGTAGCCTGTGTCTCTGTA No data
Right 1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124701604 Original CRISPR CTCAGTTCTCTGATGGGTTA AGG Intergenic
No off target data available for this crispr