ID: 1124704921

View in Genome Browser
Species Human (GRCh38)
Location 15:31955799-31955821
Sequence CTCCCCAAGGAGGTCTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124704921_1124704926 -10 Left 1124704921 15:31955799-31955821 CCTGTCTAGACCTCCTTGGGGAG No data
Right 1124704926 15:31955812-31955834 CCTTGGGGAGATGGATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124704921 Original CRISPR CTCCCCAAGGAGGTCTAGAC AGG (reversed) Intergenic
No off target data available for this crispr