ID: 1124707140

View in Genome Browser
Species Human (GRCh38)
Location 15:31975493-31975515
Sequence CGGGGCTGTCGCCAGCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124707140_1124707152 28 Left 1124707140 15:31975493-31975515 CCCAGTGGCTGGCGACAGCCCCG No data
Right 1124707152 15:31975544-31975566 GCCGCGGGGCGGCCGCCATCTGG No data
1124707140_1124707149 14 Left 1124707140 15:31975493-31975515 CCCAGTGGCTGGCGACAGCCCCG No data
Right 1124707149 15:31975530-31975552 CATCCAAGATCTGCGCCGCGGGG No data
1124707140_1124707147 12 Left 1124707140 15:31975493-31975515 CCCAGTGGCTGGCGACAGCCCCG No data
Right 1124707147 15:31975528-31975550 TTCATCCAAGATCTGCGCCGCGG No data
1124707140_1124707148 13 Left 1124707140 15:31975493-31975515 CCCAGTGGCTGGCGACAGCCCCG No data
Right 1124707148 15:31975529-31975551 TCATCCAAGATCTGCGCCGCGGG No data
1124707140_1124707151 17 Left 1124707140 15:31975493-31975515 CCCAGTGGCTGGCGACAGCCCCG No data
Right 1124707151 15:31975533-31975555 CCAAGATCTGCGCCGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124707140 Original CRISPR CGGGGCTGTCGCCAGCCACT GGG (reversed) Intergenic
No off target data available for this crispr