ID: 1124707467

View in Genome Browser
Species Human (GRCh38)
Location 15:31977725-31977747
Sequence GGGGATACCCCTGAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124707463_1124707467 -10 Left 1124707463 15:31977712-31977734 CCTCCTCTCTACTGGGGATACCC No data
Right 1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG No data
1124707458_1124707467 3 Left 1124707458 15:31977699-31977721 CCTTAAGGGAGTCCCTCCTCTCT No data
Right 1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG No data
1124707453_1124707467 18 Left 1124707453 15:31977684-31977706 CCCACAGGATGAGGCCCTTAAGG No data
Right 1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG No data
1124707462_1124707467 -9 Left 1124707462 15:31977711-31977733 CCCTCCTCTCTACTGGGGATACC No data
Right 1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG No data
1124707457_1124707467 4 Left 1124707457 15:31977698-31977720 CCCTTAAGGGAGTCCCTCCTCTC No data
Right 1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG No data
1124707455_1124707467 17 Left 1124707455 15:31977685-31977707 CCACAGGATGAGGCCCTTAAGGG No data
Right 1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124707467 Original CRISPR GGGGATACCCCTGAGCAGGT GGG Intergenic
No off target data available for this crispr