ID: 1124710554

View in Genome Browser
Species Human (GRCh38)
Location 15:32006555-32006577
Sequence AATATATTCCCACTTACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124710554_1124710561 29 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710561 15:32006607-32006629 AGGAATCTTAACCATGGGGTAGG No data
1124710554_1124710560 25 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710560 15:32006603-32006625 AAACAGGAATCTTAACCATGGGG No data
1124710554_1124710557 9 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710557 15:32006587-32006609 CATTTAAGAAAATGGAAAACAGG No data
1124710554_1124710556 1 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710556 15:32006579-32006601 TAAGGATTCATTTAAGAAAATGG No data
1124710554_1124710558 23 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710558 15:32006601-32006623 GAAAACAGGAATCTTAACCATGG No data
1124710554_1124710559 24 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710559 15:32006602-32006624 AAAACAGGAATCTTAACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124710554 Original CRISPR AATATATTCCCACTTACGTG AGG (reversed) Intergenic
No off target data available for this crispr