ID: 1124710561

View in Genome Browser
Species Human (GRCh38)
Location 15:32006607-32006629
Sequence AGGAATCTTAACCATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124710554_1124710561 29 Left 1124710554 15:32006555-32006577 CCTCACGTAAGTGGGAATATATT No data
Right 1124710561 15:32006607-32006629 AGGAATCTTAACCATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124710561 Original CRISPR AGGAATCTTAACCATGGGGT AGG Intergenic
No off target data available for this crispr