ID: 1124712860

View in Genome Browser
Species Human (GRCh38)
Location 15:32030137-32030159
Sequence CTGGGCACTCGGGAGAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124712860_1124712871 15 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712871 15:32030175-32030197 AGAGCGGGAGCGGGCTGAGTGGG No data
1124712860_1124712867 0 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712867 15:32030160-32030182 CGCAGCTTCTGGCTGAGAGCGGG No data
1124712860_1124712866 -1 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712866 15:32030159-32030181 GCGCAGCTTCTGGCTGAGAGCGG No data
1124712860_1124712872 16 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712872 15:32030176-32030198 GAGCGGGAGCGGGCTGAGTGGGG No data
1124712860_1124712870 14 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712870 15:32030174-32030196 GAGAGCGGGAGCGGGCTGAGTGG No data
1124712860_1124712868 5 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712868 15:32030165-32030187 CTTCTGGCTGAGAGCGGGAGCGG No data
1124712860_1124712869 6 Left 1124712860 15:32030137-32030159 CCGGCTTTCTCCCGAGTGCCCAG No data
Right 1124712869 15:32030166-32030188 TTCTGGCTGAGAGCGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124712860 Original CRISPR CTGGGCACTCGGGAGAAAGC CGG (reversed) Intergenic