ID: 1124712889

View in Genome Browser
Species Human (GRCh38)
Location 15:32030252-32030274
Sequence GGCTCTCGGCCTCGCGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124712889_1124712896 -3 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712896 15:32030272-32030294 GCCCGCTCGGTGGAGACTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1124712889_1124712895 -4 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712895 15:32030271-32030293 AGCCCGCTCGGTGGAGACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 112
1124712889_1124712902 27 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712902 15:32030302-32030324 GCCCGGAGCGTACCCAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1124712889_1124712893 -6 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712893 15:32030269-32030291 AGAGCCCGCTCGGTGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1124712889_1124712894 -5 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712894 15:32030270-32030292 GAGCCCGCTCGGTGGAGACTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1124712889_1124712899 0 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712899 15:32030275-32030297 CGCTCGGTGGAGACTGGGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 169
1124712889_1124712901 10 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712901 15:32030285-32030307 AGACTGGGGGTGGAGGTGCCCGG 0: 1
1: 0
2: 8
3: 76
4: 623
1124712889_1124712900 3 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712900 15:32030278-32030300 TCGGTGGAGACTGGGGGTGGAGG 0: 1
1: 0
2: 4
3: 68
4: 722
1124712889_1124712904 28 Left 1124712889 15:32030252-32030274 CCAGAGGCGCGAGGCCGAGAGCC No data
Right 1124712904 15:32030303-32030325 CCCGGAGCGTACCCAGCGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124712889 Original CRISPR GGCTCTCGGCCTCGCGCCTC TGG (reversed) Intergenic