ID: 1124713467

View in Genome Browser
Species Human (GRCh38)
Location 15:32034002-32034024
Sequence GAGAATTAACAGAAAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 457}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124713465_1124713467 2 Left 1124713465 15:32033977-32033999 CCTGTTGTAGACTTTGACAAATT 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG 0: 1
1: 0
2: 4
3: 43
4: 457
1124713464_1124713467 21 Left 1124713464 15:32033958-32033980 CCACACATGCTATTGAGCTCCTG 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG 0: 1
1: 0
2: 4
3: 43
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124713467 Original CRISPR GAGAATTAACAGAAAGATGA GGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900809933 1:4794172-4794194 GACCAGTCACAGAAAGATGACGG + Intergenic
900865633 1:5266865-5266887 GAGAATGAACAGAAAGCGCAGGG + Intergenic
901412369 1:9093364-9093386 GAGATGTAACAGAAGGCTGAAGG - Intergenic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
905036514 1:34921785-34921807 CAGAATTTACAGAAATATGTGGG - Intronic
905765095 1:40593856-40593878 GAGAAGAAAAAGAAAGAAGAGGG - Intergenic
906013791 1:42554708-42554730 GAGAATGAACACAAATATGCTGG - Intronic
906897511 1:49792479-49792501 GAAAAGTAACAGAATGATTATGG + Intronic
906967500 1:50472888-50472910 GAGAATTCAGAGAAGAATGAAGG + Intronic
907703229 1:56810042-56810064 GAGAAGGAAGAGAAAGAGGAGGG + Intronic
908880661 1:68728796-68728818 GAAAATAAAAAGAAAGATGCTGG - Intergenic
908931850 1:69326245-69326267 GAAACATAACAGAAAGTTGATGG - Intergenic
909254493 1:73401927-73401949 GAGATCTAGCAGAAAGATGGTGG - Intergenic
909263125 1:73520745-73520767 GAAAATGAACAGAAAGATACAGG + Intergenic
909714288 1:78689155-78689177 TAGAATGAAAAGAAAGAAGAAGG - Intergenic
910474654 1:87593909-87593931 TAGATTTAACAGACAGTTGAGGG - Intergenic
911179004 1:94844493-94844515 GAGAGCTAAAAGAAAGATCATGG + Intronic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911528983 1:99021086-99021108 AAGTATTTACATAAAGATGAGGG + Intergenic
911538413 1:99128643-99128665 GAAAATTAACAAAAATATGCAGG - Intergenic
912911026 1:113759287-113759309 GAGAATGAACTGGAAAATGAGGG + Exonic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
915276512 1:154792479-154792501 GAAAAGTAACAGCAAGCTGATGG + Intronic
916228306 1:162512802-162512824 GAGAATGAAGAGGAATATGAAGG + Exonic
916521452 1:165567190-165567212 GAGGATTCAGAGAAAGAAGAAGG + Intergenic
916539923 1:165743188-165743210 GAGAATATACAGGAAAATGAAGG + Exonic
917241791 1:172956645-172956667 AAGAAGTAAGAGAAAGATAATGG + Intergenic
918935966 1:190922847-190922869 GAGATTAAACAGACAGGTGAGGG - Intergenic
919235442 1:194836297-194836319 GAGAATTGAGACAAATATGATGG - Intergenic
919370410 1:196717683-196717705 GATAATTAAAAGAAAAAAGATGG + Intronic
920063192 1:203242926-203242948 GGAAATTAAAAGAATGATGAAGG + Intronic
920277930 1:204821782-204821804 GAGAATGAACAGACCGAAGAAGG - Intergenic
920537538 1:206748609-206748631 GGGAAGTGACAGAAAGAAGAGGG - Intergenic
921585114 1:216937156-216937178 GAGAATTAGCAGAAAGCTTATGG - Intronic
922144430 1:222925434-222925456 AAGAATTAAAATAAAAATGAAGG - Intronic
924030716 1:239882541-239882563 GAGAGATAACAGAGAGATGCAGG + Intronic
924119678 1:240783670-240783692 AAGTAATAACAGAAAGTTGATGG + Intronic
924864881 1:247967982-247968004 GAGATTTAAAAGGAAGAAGAAGG - Intronic
1063571802 10:7221987-7222009 GAGAATATAAAGAAAGATAAAGG - Intronic
1063649516 10:7919011-7919033 GAGGTTTAACAGGAAGGTGAAGG + Intronic
1065208210 10:23377037-23377059 GAGAATTAACTAATCGATGAAGG + Intergenic
1065308564 10:24392119-24392141 AAAAATTAAGATAAAGATGATGG + Intronic
1065990214 10:31001997-31002019 GAAAGTCAACAGAAAGAAGAGGG + Intronic
1066358762 10:34710781-34710803 GAGAATAAACAAAAACATAAGGG - Intronic
1066991318 10:42516832-42516854 GGGAATCAAAAGAAAGAGGAAGG + Intergenic
1068257664 10:54534509-54534531 GAGATTCCACAGAAAGATCAAGG + Intronic
1068438721 10:57023018-57023040 GAGATTTAAAGGAAAGAGGAAGG + Intergenic
1068779936 10:60908714-60908736 TAGCATTTACAGAAAGATGCTGG + Intronic
1069625336 10:69864379-69864401 GAGAACTAAAACAAACATGAGGG - Intronic
1070421238 10:76239222-76239244 GAGAAGGACCAGAAAGATCAGGG - Intronic
1070944550 10:80378372-80378394 GAGCAGTATCAGAGAGATGAGGG + Intergenic
1071311127 10:84345295-84345317 GAGAATTGACAGCAAGAATATGG + Intronic
1071333538 10:84584021-84584043 GAAAATAAAGAGAAAGTTGAGGG + Intergenic
1072907601 10:99468774-99468796 GAAAAAAAACAGAAATATGAGGG - Intergenic
1076341088 10:129745220-129745242 ATAAATTAACAAAAAGATGAGGG - Intronic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1077150109 11:1069212-1069234 CATAAGTAACAGAAAGATCAGGG - Intergenic
1077291695 11:1798701-1798723 GGGAATGAAAGGAAAGATGAGGG + Intergenic
1078728233 11:13952005-13952027 GAAACAGAACAGAAAGATGATGG + Intergenic
1079062690 11:17263323-17263345 GAGGCTGGACAGAAAGATGAAGG + Intronic
1079283296 11:19107099-19107121 GGGAATGAAAAGAAAGCTGAGGG - Intergenic
1079822620 11:25149859-25149881 GATATTTAACAGGAAGATTAGGG - Intergenic
1080085721 11:28279430-28279452 GAGAACAAACAGAAACATGGTGG - Intronic
1080695425 11:34599677-34599699 GGGAATTCAAAGACAGATGATGG - Intergenic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1082110948 11:48273207-48273229 CAGCATCAACAAAAAGATGAAGG - Intergenic
1082910462 11:58367879-58367901 GAGAATAAGCAAAATGATGAAGG - Intergenic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083078070 11:60062233-60062255 GAGAATGAACAGAAATGTGGGGG + Intronic
1083185169 11:61013483-61013505 GAGAATTCCCAGAACGATGGAGG - Exonic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1086116557 11:83257502-83257524 GAGAATTAAGAGATAGTTAAGGG - Intronic
1087821372 11:102716494-102716516 GAGACTTCTCAGAAAGGTGAAGG + Intronic
1088131183 11:106493059-106493081 AAGAATAGACACAAAGATGAAGG + Intergenic
1088133446 11:106524414-106524436 GAGAAGTAACATAAAGTTGCAGG - Intergenic
1088302339 11:108372786-108372808 GAGAATTACAAGAAAGATGCCGG + Intronic
1090423956 11:126594235-126594257 GAAAACTAACAGTAAGGTGAAGG + Intronic
1091076357 11:132621415-132621437 GAGAATGAACAAATAGATTATGG + Intronic
1091783742 12:3230069-3230091 GAGAAGTCCCAGACAGATGATGG - Intronic
1091926173 12:4351828-4351850 GAAAATTAAGATAAAGATTAAGG - Intronic
1093375708 12:18424988-18425010 GAGATGGAAGAGAAAGATGAGGG + Intronic
1093568414 12:20636023-20636045 AAGAAAGAAAAGAAAGATGAAGG + Intronic
1093833985 12:23803090-23803112 GAGAATTTAGAGAAGCATGATGG - Intronic
1093888099 12:24486587-24486609 GATAATGACCAGAATGATGAGGG - Intergenic
1094584699 12:31767408-31767430 AAAAATTAAAAGAAAGAGGAGGG + Intergenic
1095266006 12:40158578-40158600 GAGAATTCTCAGAAATATTAGGG - Intergenic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095741830 12:45615865-45615887 GAGAATGAACAGAATGCTCATGG - Intergenic
1095917102 12:47490790-47490812 GAGAATTAGCAGAAACTTGGGGG + Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097727512 12:63091729-63091751 TACAATTGACAGAAAGATGGAGG + Intergenic
1097992250 12:65848333-65848355 AAAAATTAACAGAAAGAAAATGG - Intronic
1098864439 12:75745915-75745937 GAGAATTAAGAGAATGCTGCAGG + Intergenic
1099123695 12:78725132-78725154 GAGAATTAGAGGAAAGATCAAGG - Intergenic
1099201223 12:79679510-79679532 GAGAAAAAACAGTAAGCTGAAGG + Intronic
1099551143 12:84044462-84044484 GAGAATTCACAAAGAGAGGATGG - Intergenic
1099862986 12:88243150-88243172 GAGAAAGAAAAGAAAGAGGAAGG - Intergenic
1100219188 12:92485553-92485575 GGAAATGAACAGAAGGATGATGG + Intergenic
1100222464 12:92520594-92520616 GAAAATTAACAGATAAATTATGG + Intergenic
1101101171 12:101394180-101394202 GAGAATGAACATAAATGTGAGGG + Exonic
1103866725 12:124058254-124058276 GATAATTGTGAGAAAGATGAAGG - Intronic
1106097898 13:26665308-26665330 GTGAATTAACACAAAGTTGTAGG - Intronic
1106656381 13:31751684-31751706 AAGAATTAAAAGAGAGGTGAAGG + Intronic
1106866309 13:33967994-33968016 GTGAATTTACAGAAAGACAAAGG + Intergenic
1107082917 13:36394258-36394280 GAAATTTAACAGAGAGATCAAGG - Intergenic
1108119664 13:47170967-47170989 GAGAAACAAAAGAGAGATGAGGG + Intergenic
1108679455 13:52766965-52766987 GAGAGTTAACATTAAGATAATGG + Intergenic
1108761778 13:53575848-53575870 GAGTATTTACAGAAACAAGAGGG + Intergenic
1108930258 13:55808640-55808662 GACAGTTAACAGGAAGATCAGGG + Intergenic
1109118323 13:58419515-58419537 TAAAATTAACAGAAAGAAGCTGG - Intergenic
1109156373 13:58915136-58915158 GAAAATTAACATAAAGAGAAGGG + Intergenic
1109911095 13:68911214-68911236 GGGAAATAAGAGAAGGATGAGGG - Intergenic
1110157281 13:72333200-72333222 GAGAAAAAAGAGATAGATGAAGG - Intergenic
1111391467 13:87601017-87601039 GAGAAGGAGGAGAAAGATGATGG + Intergenic
1111585285 13:90275999-90276021 GGCAATTAACAGAGAGATCAAGG - Intergenic
1111899186 13:94180162-94180184 GAGTATTATTAGAAAGATAAGGG + Intronic
1114689257 14:24564918-24564940 GATACTTATCAGAAAGGTGATGG + Intergenic
1114784268 14:25576884-25576906 CAGAATTAACATAAAGGTCAAGG - Intergenic
1115212936 14:30985933-30985955 GAGAATGAAAAGAGAGCTGAGGG - Intronic
1116566038 14:46445567-46445589 AAGAATTAACAGACTGATAATGG + Intergenic
1116592619 14:46798402-46798424 GAAAATTAAGGGAAAGATAATGG + Intergenic
1116809817 14:49528395-49528417 CAGAATTCAAAGAAACATGAGGG + Intergenic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1118861219 14:69665213-69665235 CCGAATTCACTGAAAGATGAGGG + Intronic
1119075712 14:71636372-71636394 TAGAAATAACAGAAACATAATGG + Intronic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1120220438 14:81726086-81726108 GGGAAATAACAGAAAGAAAAGGG - Intergenic
1120351178 14:83360704-83360726 GAGAATAAACATAAAGACAATGG - Intergenic
1120495004 14:85223897-85223919 GACAAGTTACAGAAAGGTGAGGG - Intergenic
1120504799 14:85341983-85342005 GAGAAATTACAGAAAAATAAGGG + Intergenic
1120583803 14:86287011-86287033 GAGAATTAAGAAAAAGGGGAGGG + Intergenic
1122679093 14:103443024-103443046 GAGAAAACACAGAAAAATGAGGG + Intronic
1122728082 14:103773256-103773278 GAGAATAAAATGAAAGATGAAGG + Intronic
1122755122 14:103972430-103972452 TAGAGTTAACTGAAAGTTGATGG + Intronic
1123170732 14:106370352-106370374 GAGAAGTGACAGAAAGATTTAGG - Intergenic
1123194398 14:106602593-106602615 GAGAAGTGACAGAAAGATTTAGG - Intergenic
1123199068 14:106644396-106644418 GAGAAATAAAAGAAAGATTTAGG - Intergenic
1124048220 15:26170953-26170975 GAGCATCATCAGAAAGATAATGG - Intergenic
1124366307 15:29073687-29073709 GAGAAATAACAATATGATGATGG - Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1125298506 15:38228987-38229009 GAGAAAGAAGAGAAAGAGGAAGG + Intergenic
1125344175 15:38702319-38702341 GAGAACAAACAGAAATATGCAGG - Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125839061 15:42781085-42781107 GAGAAAAAATAGAAAGATAAAGG + Intronic
1126128835 15:45321133-45321155 GAGAAGGCACAGAAAGCTGAAGG - Intergenic
1126294233 15:47119396-47119418 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1127488640 15:59441581-59441603 CAGTTTCAACAGAAAGATGAGGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127828482 15:62727582-62727604 GCGAGTGAACAGAAAGCTGAGGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128469660 15:67941544-67941566 GTGAGGCAACAGAAAGATGAAGG - Intergenic
1130813048 15:87402596-87402618 GAGAAATAAAATAAGGATGAGGG - Intergenic
1130958562 15:88644666-88644688 GAGAGTCACCAGAAAGGTGAGGG + Intronic
1131079175 15:89520199-89520221 GAGAATTAAAAGATAAATAATGG + Intergenic
1131734541 15:95318098-95318120 GAAAATGAAGTGAAAGATGAGGG + Intergenic
1131956925 15:97746908-97746930 GAGAATCAACAGAAATAAGGGGG + Intergenic
1133827904 16:9295218-9295240 GAGGATTAGCAGAAAGGAGAGGG + Intergenic
1134353987 16:13463981-13464003 GCTAATTAACAGAAAGATCCAGG + Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134827918 16:17299303-17299325 GGGAAATAACAGAATGAAGAGGG + Intronic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135483439 16:22842648-22842670 GAAAATAAGCAAAAAGATGATGG - Intronic
1135842215 16:25887170-25887192 AAGGAGTAACAGAAAGCTGATGG + Intronic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1137873952 16:51977471-51977493 AAGAATGAACAGAATGGTGATGG - Intergenic
1137972933 16:53003494-53003516 GAGAAAGAATAGAAAGAGGAGGG + Intergenic
1138486211 16:57345682-57345704 AAAAATAAACAAAAAGATGAAGG + Intergenic
1139289917 16:65848471-65848493 AAGATTTAACAGAAAGAAGAAGG + Intergenic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1139759146 16:69170296-69170318 GAGAATTAACAGAGAGAGAGAGG + Intronic
1140097783 16:71890328-71890350 GAGAAAGAAGGGAAAGATGATGG - Intronic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1144068949 17:11650046-11650068 AATAATTAAAAGAAAGATGTGGG - Intronic
1144602272 17:16627567-16627589 GAGAATTAACAGGCATTTGAAGG - Intronic
1145044525 17:19602696-19602718 TAGAATTAACAGCAGGATGATGG - Intergenic
1145968545 17:28939509-28939531 GAGAATCAGCAGAACTATGATGG + Intronic
1148927849 17:51103238-51103260 GATAATTAACAGAAATTTGTTGG - Intronic
1148947981 17:51282458-51282480 GAAAATGAAGAGAAAGAGGAAGG + Intronic
1149080295 17:52648225-52648247 GAGAAATAATAGAAACCTGATGG + Intergenic
1149332379 17:55597876-55597898 GAGAATAAAAACAAAGCTGAAGG - Intergenic
1150190753 17:63235465-63235487 AAGAATTAAAAGAGAGATGAGGG - Intronic
1150838145 17:68583218-68583240 GAAAACTAATAGAAAGATGGAGG - Intronic
1153438672 18:5093030-5093052 GAGAATGAACAAAAAGTTAAGGG + Intergenic
1153945044 18:10010565-10010587 GAGAATGAGCAGAATGATGCTGG - Intergenic
1155489042 18:26380882-26380904 AAAAATGAACAGCAAGATGATGG - Intronic
1155656430 18:28198153-28198175 GAGGATTAACAAAAAGATTCAGG + Intergenic
1156739501 18:40305997-40306019 GAGAATCCACAGGAAGAAGATGG - Intergenic
1156805984 18:41182761-41182783 TAGGAATAACAGAAAGATAATGG - Intergenic
1157058800 18:44262248-44262270 CAGAATTAACAGAAAACTGATGG - Intergenic
1157836912 18:50912609-50912631 AAAAATTAACAAAAATATGAGGG - Intronic
1158066538 18:53416892-53416914 GACAATTAGTAGAAAGCTGAGGG + Intronic
1158276071 18:55768930-55768952 GAGAATGAAAAGAAAGATGGTGG - Intergenic
1159689941 18:71475085-71475107 GAAAATTAACAGAAACAAGAAGG - Intergenic
1159833220 18:73303948-73303970 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1160060680 18:75526495-75526517 TAGAATTAGCAGAAACACGACGG + Intergenic
1160060702 18:75526606-75526628 TAGAATTAGCAGAAACACGATGG + Intergenic
1162083937 19:8237193-8237215 GATAATGAACAGAAAGCTGGAGG - Intronic
1163050210 19:14677510-14677532 GAGAATGGCCAGAGAGATGAGGG + Intronic
1164612108 19:29639524-29639546 AAGAATAAACAGCCAGATGAAGG + Intergenic
1164638167 19:29806506-29806528 GAGATTTAAATGAAAGCTGAGGG + Intergenic
1164948991 19:32320374-32320396 GAAAATTAACAGACAAATAACGG + Intergenic
1165916393 19:39263733-39263755 GAGAAAGCAGAGAAAGATGAAGG + Intergenic
1167800373 19:51736840-51736862 GAGAGATAACACAGAGATGAAGG + Intergenic
927179193 2:20432324-20432346 GAGAAGGAAAAGGAAGATGAGGG + Intergenic
928351039 2:30555351-30555373 GAGAACTAACAGAAAGACATAGG + Intronic
929250301 2:39746878-39746900 GACAATAAACAGAAAGAACAAGG - Intronic
929663573 2:43815095-43815117 GTGATTAAACAGAAAGTTGAAGG + Intronic
931099301 2:58977380-58977402 AGAAATTAACATAAAGATGAAGG - Intergenic
931159055 2:59667956-59667978 GAAAATTAGCTGAAAAATGATGG - Intergenic
931695341 2:64866645-64866667 GAGAAATTCCAGATAGATGATGG - Intergenic
931873278 2:66484388-66484410 GAGAATGAATAGAAAAATAAAGG - Intronic
931957007 2:67438743-67438765 GAGAATTAAAAAACAGAAGAGGG - Intergenic
932949987 2:76281693-76281715 CACAATTAAGAGAAAGATGAGGG - Intergenic
933310229 2:80651760-80651782 GAGTAATATCAGAAAGATGGTGG + Intergenic
933781355 2:85804063-85804085 GAGAATGAAGAGAATGATGCAGG - Intergenic
934149114 2:89128581-89128603 GAGAGTAAAGAGGAAGATGATGG - Intergenic
934218181 2:90053461-90053483 GAGAGTAAAGAGGAAGATGATGG + Intergenic
935225372 2:101047761-101047783 GGGAATTATCAGAAAGAAGAGGG - Intronic
935277181 2:101485094-101485116 GAGAATGAAGAGGAAGATGGGGG - Intergenic
935381687 2:102457950-102457972 GATTATTAAGAGAAAGATGGTGG + Intergenic
935881141 2:107566870-107566892 GCGAATTTTCAGGAAGATGATGG + Intergenic
937188923 2:120073907-120073929 GAGAGTTAATAGTAATATGATGG + Intronic
939024241 2:136993006-136993028 GAGCATGAGTAGAAAGATGAAGG - Intronic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939193958 2:138949480-138949502 GAGAGTTAACAGAATAAAGAAGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939606404 2:144260287-144260309 GAGAACTAAGAAAAAAATGAAGG - Intronic
939640986 2:144639590-144639612 GGGAATGAACAGAAATATTATGG - Intergenic
941218510 2:162744392-162744414 GAAAAATAACAGAACCATGAGGG - Intronic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943968158 2:194366110-194366132 GATAATAATCAGAAAGAAGAAGG + Intergenic
944052167 2:195482535-195482557 GAGAATTTACAGGAAGAATATGG + Intergenic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
945096786 2:206228030-206228052 GAGAATGAAAGGAGAGATGAGGG + Intergenic
945415352 2:209564146-209564168 GAAAATGAATAGAAAAATGAAGG + Intronic
945563040 2:211362049-211362071 GAGAATCAGCAGTGAGATGAAGG - Intergenic
945601404 2:211870038-211870060 GAGAAAGAAAAGGAAGATGATGG - Intronic
945645512 2:212487113-212487135 GAGAATTAAAAGAAATATCAAGG - Intronic
945746562 2:213725614-213725636 GGGAATTTACATAAAGAAGAGGG + Intronic
945896140 2:215483879-215483901 GAGAATCAGCAGTGAGATGAAGG - Intergenic
945923951 2:215784524-215784546 GAGAATAAACACAAAGCTCAAGG + Intergenic
946382791 2:219360062-219360084 TAAAAATAAAAGAAAGATGATGG - Intergenic
947447946 2:230179131-230179153 GAGCATTGACGGAAAGGTGAAGG + Intronic
947681566 2:232038306-232038328 AAGAAAGAACAGAAAGATGGTGG + Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
949077292 2:242069024-242069046 GAGAATGAAGTGAAAGAGGAGGG - Intergenic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1170935653 20:20806613-20806635 GAGAATTTGCAGAAATGTGATGG + Intergenic
1170959586 20:21013287-21013309 GATAATGAACTGAAAGATCAAGG - Intergenic
1173194440 20:40902733-40902755 CAGAATTAAAAGAAACAGGAGGG + Intergenic
1173418175 20:42877110-42877132 CATAATGAACAGAAAGCTGAAGG + Intronic
1173440196 20:43068623-43068645 GAGATTTAAGAGCAAGATCAAGG + Intronic
1174763531 20:53229972-53229994 GAGAAAGAAAAGAAAGAGGAAGG + Intronic
1174792860 20:53496635-53496657 GAGAAGTCACAGAAGGATGAAGG + Intergenic
1175055893 20:56197735-56197757 GACATTGAACAGAATGATGAGGG + Intergenic
1175544177 20:59767475-59767497 GTGAATAAATAGATAGATGATGG - Intronic
1177301800 21:19256232-19256254 AAGAAATAAAGGAAAGATGAAGG + Intergenic
1177591895 21:23181963-23181985 GAAAATAAACAGAAAAATGCAGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1179530250 21:42013386-42013408 GAGATTTGACAGACAGAAGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184869405 22:47225824-47225846 GAGAAAGGACAGAGAGATGATGG - Intergenic
949098545 3:115180-115202 AAAAATTAACAGTATGATGAAGG + Intergenic
949267538 3:2175941-2175963 GAGATTTAACTTAAAGATGAAGG - Intronic
950728788 3:14937934-14937956 GAGAATTAAATGAAAGAACAGGG - Intergenic
950757277 3:15185891-15185913 GAGAATAAATAGAAAGAAAATGG - Intergenic
950802430 3:15564823-15564845 AATAATTAACAGAAACATCATGG + Intronic
951168394 3:19508905-19508927 GAGATATAAGAGAAAGATGCTGG - Intronic
951537389 3:23752145-23752167 GACATTTAACAGAAAGGAGATGG + Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
954876550 3:53806270-53806292 CAGACTTGACAGGAAGATGAGGG - Intronic
954944958 3:54415089-54415111 TATAATTAACAGAACCATGAAGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957745058 3:84329838-84329860 CAGAATTAGAAGAAATATGATGG - Intergenic
959302751 3:104623409-104623431 GATAGTAAAAAGAAAGATGAGGG + Intergenic
960091542 3:113644704-113644726 GAAAAATAACAGAAAAATGATGG - Intergenic
960138731 3:114131476-114131498 GAGAATTCAAAGAAGGAAGACGG + Intronic
960267831 3:115640978-115641000 GAGAAATAGAAGAAAGAAGAAGG - Intronic
960470219 3:118055178-118055200 GAAAATTAAAAGAAACATGATGG - Intergenic
961588225 3:127953237-127953259 GGGCATTAACAATAAGATGACGG - Intronic
961995804 3:131241105-131241127 GAGAATGAAAATAAATATGAAGG + Intronic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
963131090 3:141858501-141858523 TAGAAAGAAAAGAAAGATGATGG + Intergenic
963462752 3:145637819-145637841 GAGAATGATGAGAATGATGAAGG - Intergenic
963600478 3:147374074-147374096 GAGAATTAAGAGAGAGATGGTGG - Intergenic
963603836 3:147397821-147397843 GAAAAGGACCAGAAAGATGAGGG - Intronic
963693035 3:148529026-148529048 GAAAATTAACACACAGATTAAGG + Intergenic
963781178 3:149487960-149487982 GAGAAATAACTAAAAGAGGACGG + Intronic
963855388 3:150247970-150247992 GAGAAGAAAAAGAAAGGTGAAGG - Intergenic
964047671 3:152350048-152350070 GAGAATGTACAGTAAGAAGAAGG + Intronic
964182407 3:153904368-153904390 GAGAAATAAAAGAAAGTAGATGG + Intergenic
964493174 3:157258961-157258983 AAGAATTAAGGGAAAGATGAAGG - Intergenic
964955657 3:162352918-162352940 AAGAATTAAAAGAAACAAGAAGG - Intergenic
966417360 3:179703162-179703184 GAGAATTATTTGGAAGATGAGGG + Intronic
966626110 3:182018871-182018893 GAGAAAGAAAAGAAAGAAGAGGG - Intergenic
966696708 3:182797014-182797036 GAGGAAGAACAGAAAGTTGAGGG - Intronic
967553744 3:190830994-190831016 GAGAAAGAACGGAAAGAGGAAGG + Intergenic
967581205 3:191157111-191157133 GAGAACTTACAAAAAGATCATGG + Intergenic
967687022 3:192429424-192429446 GAGAAATAAGAGAAAAATGTTGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967773622 3:193361439-193361461 CAGAATTATCAGAATTATGAGGG + Intronic
968259823 3:197311663-197311685 GGGAAGGAAGAGAAAGATGAAGG - Intergenic
968861459 4:3174402-3174424 GAGATTTGAGAGAAAGGTGAAGG - Intronic
970290496 4:14565913-14565935 GAGAAAGAAGAGAAAAATGAAGG - Intergenic
970610718 4:17722595-17722617 GAGACTTAGCTGAAAGACGAGGG + Intronic
971132219 4:23824992-23825014 GAAAATTAATTGAGAGATGATGG + Intronic
971676894 4:29642958-29642980 TAGAATCAAAAGAAAGATCAAGG - Intergenic
971740576 4:30515362-30515384 GAGAAATAACAGAGAGAATAAGG - Intergenic
971781305 4:31037897-31037919 GACAAGTGACAGATAGATGATGG + Intronic
972026184 4:34381399-34381421 GAGAATTGGTAGAAAAATGAAGG + Intergenic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
973270017 4:48253479-48253501 GAGAAAGAACAAAAAGAAGAGGG - Intronic
974169544 4:58248237-58248259 GTTAATTAACAGAAAAATCAAGG - Intergenic
974302329 4:60083879-60083901 GAAAATTAACAGACAGATTCAGG + Intergenic
974832002 4:67201182-67201204 GAGAATTCACAGAAAGAAGCAGG - Intergenic
975088444 4:70371700-70371722 GAAAAGCAACAGAAAGATGTTGG - Intronic
975196689 4:71533374-71533396 CAGAATTATGAGACAGATGATGG + Intronic
975294132 4:72712513-72712535 CAGAATTAGCAGTCAGATGAGGG - Intergenic
976106541 4:81625080-81625102 TGGTATTAAAAGAAAGATGAGGG + Intronic
976125694 4:81831876-81831898 GATAATTAAGGGAAAGCTGATGG + Intronic
976947196 4:90784966-90784988 GAGGAGGAACAGGAAGATGAAGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
978416753 4:108485027-108485049 GAAAATAGACAGATAGATGAAGG + Intergenic
978942262 4:114450433-114450455 GAGAAATTACATAATGATGAAGG + Intergenic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
980212480 4:129807720-129807742 GAGAATTGAAAGAAATGTGAGGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980627625 4:135393858-135393880 GAGAAGACACAGCAAGATGATGG - Intergenic
981664166 4:147202685-147202707 GAGACTTAATAGAATGATGGAGG + Intergenic
981820703 4:148883943-148883965 GAGAATTAAAACTAAGATGTTGG - Intergenic
982405767 4:155018603-155018625 GAAAATTAACAGAAATCTTAGGG + Intergenic
982463290 4:155698247-155698269 TAGACTTAGCAGAAAGTTGAGGG + Intronic
983129537 4:163999116-163999138 GATAATTACCAAAAAGATGAAGG - Intronic
983483232 4:168301426-168301448 TAGAAAGTACAGAAAGATGAGGG + Intronic
983524006 4:168741837-168741859 GAGAATAAACAGAAACATTTTGG + Intronic
983857963 4:172668807-172668829 GAGAAGTAAAAATAAGATGAGGG + Intronic
984552011 4:181171671-181171693 AAGAAATAAAAGAAAGAAGAGGG - Intergenic
985231726 4:187825508-187825530 GAAAATTAAAAAAAAAATGATGG + Intergenic
986559161 5:9043615-9043637 GAGGATTAAAATGAAGATGAAGG + Intronic
987187185 5:15434787-15434809 GAAAATGAACAGCAAGATGGTGG + Intergenic
987771870 5:22315580-22315602 GAGATTCATCAGAAAGGTGAAGG + Intronic
988015356 5:25550438-25550460 GACAATAAATAGAAAAATGAAGG - Intergenic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988106050 5:26749915-26749937 GAGGATAAACAGGAAAATGAAGG - Intergenic
988821233 5:34888140-34888162 GTGAGTTTACAGAAAGAAGATGG + Intronic
988840055 5:35074794-35074816 AAGAATTAAAAAAAAAATGAAGG + Intronic
989490521 5:42047562-42047584 GAGCATTAGCAGAGAGATGGAGG + Intergenic
989549174 5:42712973-42712995 AAGATTTATCAAAAAGATGAAGG - Intronic
989812093 5:45690507-45690529 TAGAATTAACAGAGCCATGAAGG + Intronic
991476964 5:67032113-67032135 GATAATTCACAGAAAGATTTAGG - Intronic
992683378 5:79175481-79175503 GAGAAATGACATAAAGTTGATGG + Intronic
993003181 5:82403356-82403378 GAAAAGGAACAGAAAGATAAGGG - Intergenic
993492073 5:88564401-88564423 GAGGATTAAAACATAGATGAGGG - Intergenic
995314550 5:110753257-110753279 GAGAGGTAACTGGAAGATGAGGG + Intronic
996112256 5:119579838-119579860 GAGAATGAACACAATGGTGAAGG - Intronic
996701438 5:126454077-126454099 GAGAATCAACACATAGAGGAAGG + Intronic
996723987 5:126657821-126657843 GCTTTTTAACAGAAAGATGAAGG - Intergenic
996981484 5:129501199-129501221 GAGAATTAAAAGAAAGGAAAAGG + Intronic
997191647 5:131942590-131942612 GAGGAAAAACAGAAAGCTGAGGG + Intronic
997443288 5:133923897-133923919 GAGAATTTACAGACAGAAAAAGG - Intergenic
997755571 5:136395741-136395763 GAGAGGTAAGAGAAAGATGCAGG + Intronic
997804640 5:136905092-136905114 GAGGAGGAAGAGAAAGATGAAGG - Intergenic
997904217 5:137798725-137798747 AAGAATTAGCAGACAGATCAAGG - Intergenic
998695090 5:144629904-144629926 GAGAATGAGGAGCAAGATGATGG + Intergenic
998722069 5:144963990-144964012 GAAAGTTAACAGAAAAGTGAAGG + Intergenic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999605395 5:153308570-153308592 AAGGCTTAACAGAAAGATCATGG - Intergenic
1000305805 5:159993553-159993575 GAGAACTATAAGTAAGATGAGGG + Intergenic
1000596588 5:163221528-163221550 GAAATTTAACAGGAAGATGCAGG + Intergenic
1001123305 5:168997434-168997456 TAGAATTAACTGAAAGAGGGAGG + Intronic
1002843983 6:929762-929784 GAGAATTTACAGAAAGCTGCTGG + Intergenic
1002924538 6:1597367-1597389 GAGAATTAACATGAGGATGGGGG - Intergenic
1003516229 6:6821199-6821221 GAGAATTAATAAAAAGGTGTGGG + Intergenic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1004032720 6:11887232-11887254 GAAAATTACCAGAAACATAAAGG + Intergenic
1004297808 6:14429938-14429960 GAGAAGTAACAGAAAAAAAAGGG + Intergenic
1004816909 6:19321223-19321245 GATAATTGAAAGAAAGTTGAGGG - Intergenic
1005065964 6:21817824-21817846 TAAAATTAAAAGAGAGATGATGG - Intergenic
1005496452 6:26392281-26392303 GAGAAGTCTCAGAAAGCTGAAGG - Intronic
1008229187 6:48963167-48963189 GGGAATTAAGAGAAAGAAGATGG - Intergenic
1009790624 6:68397230-68397252 GAAAATTATCAGGAAAATGAAGG + Intergenic
1009918631 6:70028338-70028360 GACAAGTTACAGAAAGGTGAAGG + Intronic
1010314372 6:74429031-74429053 GAAAATTCATAGAAAAATGAAGG - Intergenic
1010377772 6:75192972-75192994 GAGAATTAACAGAATCTAGAAGG - Intronic
1011703291 6:89975460-89975482 GAGAAACAAAAGAAAGCTGAGGG - Intronic
1012021742 6:93930841-93930863 GAGAATTAAAATAATGTTGATGG + Intergenic
1012166632 6:95962249-95962271 AAGAATTACCAGAAATATCAAGG - Intergenic
1012195117 6:96332300-96332322 AAAAAGTAATAGAAAGATGAGGG - Intergenic
1012345991 6:98186726-98186748 AAGAATGAACTGTAAGATGAGGG - Intergenic
1012366591 6:98448151-98448173 GAGAGTTAACAGATAGTTTAGGG - Intergenic
1012380150 6:98611303-98611325 GAGAATGAATATAAAGATCATGG - Intergenic
1012617739 6:101297989-101298011 GAGAATTGAGAGAAATATAAGGG + Intergenic
1012712859 6:102630260-102630282 GAGAAAGAATAGAAAGAGGAGGG + Intergenic
1012962911 6:105641570-105641592 AAGAGTGAACAGAAAAATGATGG - Intergenic
1014806373 6:125834116-125834138 GAGTATTAACAGAAATATGTGGG + Intronic
1014866201 6:126533326-126533348 GAAAATTTACAGAAACATGTAGG - Intergenic
1014937334 6:127399871-127399893 GATACTTGACAGAAAGCTGATGG - Intergenic
1015119606 6:129686752-129686774 GGGAATTCAGTGAAAGATGACGG - Intronic
1015457496 6:133444343-133444365 GATAATTAACATAAAAAAGATGG - Intronic
1015669779 6:135675321-135675343 AAGAATAAATAGAAATATGAGGG - Intergenic
1015929441 6:138342816-138342838 GAAAATTAAATGAAAGATGAAGG - Exonic
1016251011 6:142042964-142042986 GAGAAATAAATGAAAGATTAGGG + Intergenic
1016572301 6:145528471-145528493 GAGAATTAACATAATTCTGAAGG - Intronic
1016683369 6:146855351-146855373 GGGAACCAACAGAAAAATGAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019345606 7:528798-528820 GATAATGAATAGACAGATGATGG + Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020028846 7:4919152-4919174 CAGAATTATTAGAAAGATTAGGG + Intronic
1020477304 7:8612152-8612174 GAGAAATGACAGAAAGAGAAAGG - Intronic
1021807490 7:24371692-24371714 CAGAAGTATCAGAAAGATGATGG - Intergenic
1022467617 7:30662144-30662166 GAGAATGAACAGTAAGTGGATGG - Exonic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023553823 7:41399157-41399179 TAAAATTCACAGAAACATGAGGG + Intergenic
1024456321 7:49611659-49611681 GAGAATTAAGAAAAAAATGCTGG + Intergenic
1024773767 7:52758222-52758244 GAGAATTACAAGAAAAATGGGGG - Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1026070463 7:67114464-67114486 GAGATTTAAAATTAAGATGAAGG + Intronic
1026706436 7:72697814-72697836 GAGATTTAAAATTAAGATGAAGG - Intronic
1027739325 7:81980133-81980155 GAGAATTAATGGAAAAAAGAAGG + Intronic
1028076218 7:86518787-86518809 GAGAATTAATAGAAAGTGGATGG - Intergenic
1028210593 7:88069361-88069383 TAGAATGAACAGAAATATGTTGG - Intronic
1029018632 7:97340590-97340612 GAGAATTATCTGCAGGATGATGG + Intergenic
1030547607 7:110917125-110917147 GAGAAGTCACATAAAGATGGAGG + Intronic
1030927196 7:115472957-115472979 GAGAATAAACAGGAAACTGAAGG + Intergenic
1032441849 7:131948164-131948186 GAGAATTTCCAGGAAGGTGAAGG + Intergenic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1036048537 8:5170276-5170298 GAGAAGTCACAGGAGGATGAGGG + Intergenic
1036483485 8:9158834-9158856 AAGAATTAACAGAAAGAAAATGG - Intronic
1037728631 8:21505208-21505230 GACAAATAAGAGAAAGAAGAAGG + Intergenic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1041033502 8:53762616-53762638 AAGAATAAACAAATAGATGATGG + Intronic
1041142757 8:54840732-54840754 AAGGATGAACAGAAAGATGCAGG - Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1041557670 8:59176075-59176097 GTGAAAGAAGAGAAAGATGATGG + Intergenic
1041802124 8:61811969-61811991 GAGGTTTAAAAAAAAGATGATGG - Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042519324 8:69694427-69694449 GTCAATAAAGAGAAAGATGAAGG - Intronic
1043520508 8:81040255-81040277 GAGACTGAACAGAAATATCATGG - Intronic
1043606013 8:82000779-82000801 CAGAATTATTAGAATGATGAAGG - Intergenic
1044357296 8:91237853-91237875 GAGAAAACAAAGAAAGATGAGGG - Intronic
1045286977 8:100800314-100800336 GAGGATTAAGAGAAAGACTAGGG - Intergenic
1045551440 8:103176407-103176429 TAGATTTAAAAGAAAGAAGAAGG + Intronic
1046037765 8:108864601-108864623 GAAAATTAACAGAGGGATGAAGG + Intergenic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046118152 8:109809613-109809635 GGGAATTAAGAAACAGATGACGG + Intergenic
1046550892 8:115714864-115714886 GAGAATTCACAACAAGATTACGG - Intronic
1046653226 8:116863430-116863452 ACGAATTAACACAAACATGAAGG + Intronic
1047566399 8:126048110-126048132 GGGAATCCACAGAAACATGAAGG - Intergenic
1048629022 8:136220350-136220372 GAGAAGGAACAGAAAGAGAAGGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048739497 8:137538827-137538849 GAGAAGAAAAATAAAGATGAGGG + Intergenic
1050854827 9:10340004-10340026 GAGTATGAACAGAAACCTGAAGG - Intronic
1051346593 9:16156370-16156392 GAAACTTAACAGTAAGATAAAGG - Intergenic
1052130802 9:24844302-24844324 GAGAATAAACAGAAACACTATGG - Intergenic
1052189224 9:25638064-25638086 GAGAATTAACATAAATAGAAGGG + Intergenic
1053033389 9:34802491-34802513 GAGTATTAACAGAAACATAATGG - Intergenic
1055437297 9:76304492-76304514 GAGAATCAACAGGAAGCTGAAGG + Intronic
1055867985 9:80839017-80839039 AAGAAATAACTGAAATATGAAGG + Intergenic
1056160538 9:83887071-83887093 TACAATTAACATCAAGATGAAGG - Exonic
1056838308 9:89976095-89976117 AAGAATTAACAGGAAGCTGCAGG + Intergenic
1056873327 9:90304986-90305008 AAGAAGTAACAGAAACATCAAGG - Intergenic
1057501257 9:95598230-95598252 GAGACTTATCAGAAGGCTGAAGG + Intergenic
1058397583 9:104572542-104572564 TGGAAATAACAGAAAGAAGAAGG + Intergenic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1059868266 9:118541692-118541714 GAGAAAGAAAAGAAAAATGAAGG - Intergenic
1060073065 9:120567425-120567447 GATACTTAACAGAGAGAAGATGG - Intronic
1185939236 X:4296508-4296530 GACAGATAACAGATAGATGATGG + Intergenic
1186972941 X:14868936-14868958 GGCAATTAACAGAAAGATCTGGG + Exonic
1187555864 X:20350534-20350556 TAGAATTAACTGAAAGGAGATGG - Intergenic
1188297657 X:28469660-28469682 AAGCCTTAACAGAAAGGTGATGG - Intergenic
1188681357 X:33011413-33011435 GACAATTTCAAGAAAGATGAAGG - Intronic
1188835556 X:34949828-34949850 GAAAATTAACAAAAACATGAAGG + Intergenic
1188836375 X:34960886-34960908 GGGAATTAACATAAAGAAAAGGG + Intergenic
1189560921 X:42190832-42190854 GTGAATTAACAGAATGAATAGGG - Intergenic
1189600984 X:42625739-42625761 GAGAATTAATAGAAAAATAAAGG - Intergenic
1191093700 X:56652614-56652636 GAAAATTAACAAAAGGATTAAGG - Intergenic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1193017574 X:76752824-76752846 GAAAACAAACAGAAATATGAAGG + Intergenic
1193327334 X:80194650-80194672 GAGAATTATCAAAAAGACAAAGG - Intergenic
1193744224 X:85255483-85255505 GAGGATTTAGAGGAAGATGATGG + Exonic
1194027595 X:88772516-88772538 GAGAATGCACAGCAAGATGGTGG - Intergenic
1194551452 X:95306045-95306067 GAGAAATAAAACAAAGTTGAAGG + Intergenic
1196916836 X:120545758-120545780 GAGAAGTAACTGAAAAATCAAGG + Intronic
1197565796 X:128084395-128084417 GAGAAGAAACATAAAGATAAAGG + Intergenic
1197605441 X:128580070-128580092 GAGACTTATAATAAAGATGATGG - Intergenic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1198239551 X:134770076-134770098 AAGAAATAACTGAAATATGATGG - Intronic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1198706365 X:139452860-139452882 GAGAATGAAAAGAGAGATGATGG + Intergenic
1198839767 X:140843912-140843934 GAGAACTCACAGAAGAATGATGG + Intergenic
1199732641 X:150651676-150651698 GAGACTTAACACAGAGATGTTGG + Intronic
1200641488 Y:5723617-5723639 GAAAATAAAAAGAAAAATGACGG + Intronic