ID: 1124714188

View in Genome Browser
Species Human (GRCh38)
Location 15:32043829-32043851
Sequence CTCAAGAAAGAGAAGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 537}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124714188 Original CRISPR CTCAAGAAAGAGAAGTCTAA AGG (reversed) Intronic
900602580 1:3509429-3509451 CTCAGGAAAGAGAAGGCTCTGGG + Intronic
900773974 1:4567791-4567813 ATAAAGAAAAAGAGGTCTAATGG - Intergenic
900817227 1:4857731-4857753 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
900901392 1:5518787-5518809 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
901005168 1:6168169-6168191 CTCAAGGAAAACAAGTGTAAAGG - Exonic
901858902 1:12062123-12062145 CTCCAGGAAGAAAACTCTAAAGG + Intergenic
902688484 1:18094793-18094815 ATAAAGAAAAAGAGGTCTAATGG + Intergenic
902752880 1:18529557-18529579 ATAAAGAAAAAGAAGTTTAACGG - Intergenic
903062280 1:20678063-20678085 ATAAAGAAAAAGAAGTTTAATGG + Intronic
903479623 1:23643867-23643889 CTCAAGAGAGAGAGGTCGTAGGG + Intergenic
903702816 1:25263354-25263376 CAAAAGAAAGAGAGGTTTAATGG + Intronic
903712082 1:25333680-25333702 CAAAAGAAAGAGAGGTTTAATGG + Intronic
909845278 1:80386428-80386450 CTCAAGCAAGAGAAGGAAAATGG + Intergenic
910036770 1:82798497-82798519 ATAAAGTAAGAGAAGTTTAATGG + Intergenic
910117604 1:83749459-83749481 CTTAAGAATGATAAGTCTTAGGG - Intergenic
910958770 1:92738008-92738030 CCCAAGAAAGAAAAGTTGAATGG + Intronic
912080524 1:105931107-105931129 CAAAAGAAAGAGAGGTTTAATGG - Intergenic
913313557 1:117530010-117530032 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
915126572 1:153669831-153669853 CTCACCAAATAGAAGTCAAATGG + Exonic
916052940 1:161048856-161048878 GCCAAGGAAGAGAAGTCCAAAGG - Exonic
916374233 1:164134371-164134393 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
916449211 1:164903702-164903724 ATAAAGAAACAGAAGTTTAATGG - Intergenic
916777867 1:167987515-167987537 CACAAGAGAGAAAAGTGTAAGGG - Exonic
916809928 1:168296359-168296381 ATAAAGAAAAAGAAGTTTAATGG + Intronic
918197848 1:182239432-182239454 CTGAAGGCTGAGAAGTCTAAGGG + Intergenic
918797239 1:188916638-188916660 ATGAAGAGAGAGAAGTCAAATGG + Intergenic
918987794 1:191655843-191655865 TTCATGAAAGAAAACTCTAAAGG - Intergenic
919408450 1:197213788-197213810 TTCAAAAAAGAAAAGTCAAAAGG + Intergenic
919514175 1:198501052-198501074 GTAAAGAAAGAGAGGTTTAATGG - Intergenic
919825935 1:201503143-201503165 CTCAAAAAAAAGAAGTCTGAAGG + Intronic
921055686 1:211540912-211540934 CAAAAGAAAGAGAAGTTTGATGG + Intergenic
921160431 1:212468480-212468502 CTCAAGAAAGGGAAGACAAGAGG - Intergenic
921282085 1:213577324-213577346 ATAAAGAAAAAGAGGTCTAATGG - Intergenic
921429018 1:215041879-215041901 ATAAAGAAAAAGAAGTTTAACGG + Intronic
923757971 1:236811036-236811058 CAGAAGAAAGAGAGGTTTAATGG + Intronic
923764163 1:236877358-236877380 ATCAAGAAATAGAACACTAATGG + Intronic
924254314 1:242167267-242167289 ATAAAGAAAAAGAAGTTTAATGG + Intronic
924382503 1:243477356-243477378 CTCAAGCAAGAACAGACTAATGG - Intronic
1064279813 10:13941375-13941397 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1064941602 10:20741540-20741562 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1065632424 10:27694100-27694122 ATCAAGAAAAAGAGGTTTAATGG - Intronic
1065705329 10:28467008-28467030 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1067548363 10:47213772-47213794 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1067731732 10:48817638-48817660 CTCAGTAATGAGAAGTCTAATGG + Intronic
1067812056 10:49437242-49437264 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1070085474 10:73232872-73232894 GTCAAGGAAGACAAGACTAACGG - Intronic
1070387066 10:75935195-75935217 CCCAAGAAAGAGAAGGGCAAGGG + Intronic
1072701440 10:97644478-97644500 CTCATGTAAAAGAAGTCTATAGG + Intronic
1073887448 10:108056492-108056514 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1073945655 10:108747140-108747162 CTCAAGACAGAAAAGTGCAAGGG + Intergenic
1074042733 10:109808921-109808943 CGGAAGAAAAAGAAGTTTAATGG + Intergenic
1074128639 10:110552877-110552899 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1074291194 10:112139135-112139157 CTAAAGAAAAAGAGGTTTAATGG - Intergenic
1075126845 10:119707440-119707462 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1075530665 10:123226339-123226361 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1076276465 10:129203464-129203486 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1076389006 10:130082673-130082695 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1078643568 11:13118007-13118029 CTTCAGAAAGAGAAGGCAAATGG - Intergenic
1079301042 11:19279042-19279064 TTAAAGAAAAAGAAGTTTAATGG - Intergenic
1080070724 11:28082855-28082877 CTCAGGAAAAAGAAATCGAAAGG - Exonic
1080280942 11:30555727-30555749 ATCAAGAAAAAGAGGTTTAATGG - Intronic
1080991910 11:37546572-37546594 CAGAAGAAAGAGAAGTTTAAAGG + Intergenic
1081451429 11:43174050-43174072 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1082619737 11:55405486-55405508 CTCAAGTAAGAGAATCCTAAAGG + Intergenic
1082623041 11:55447764-55447786 CTCAAGTAAGAGAATCCTAAAGG + Intergenic
1082637031 11:55608820-55608842 TTGAAGAAAAAGAAGTTTAATGG - Intergenic
1083690286 11:64404155-64404177 TGCAAAAAAGAGAACTCTAAGGG - Intergenic
1084111797 11:67019038-67019060 ATAAAGAAAGAGAGGTTTAAAGG + Intronic
1085172091 11:74457987-74458009 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1085551919 11:77381897-77381919 TTTGAGAAAGAGAAGGCTAAGGG + Intronic
1086194945 11:84126425-84126447 CCAAAGAAAGAAAACTCTAAAGG + Intronic
1086269796 11:85048532-85048554 ATCAATATAAAGAAGTCTAAAGG - Intronic
1087462750 11:98466079-98466101 CTCAAGAAAGAAAAGGATAATGG - Intergenic
1089099411 11:115949132-115949154 CTCAAGAAAGTGAATACTATTGG - Intergenic
1089662859 11:119996858-119996880 GCCAAGAAAGAGAAGTATGAAGG - Intergenic
1089664285 11:120007924-120007946 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1089913987 11:122134328-122134350 CAAAAGAAAGAGCTGTCTAAGGG + Intergenic
1090392159 11:126395796-126395818 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1090600899 11:128370157-128370179 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1090835787 11:130452522-130452544 CTAAAGACAGAGAAGTCTCAGGG - Intronic
1091308951 11:134559474-134559496 CTCTACAAAGAGAAGGCTGAGGG + Intergenic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1093110183 12:15142684-15142706 CTCAAGAAAGAGAAGAGAGAGGG + Intronic
1093136366 12:15456588-15456610 TTCAACAAAGAAAAGTCAAATGG - Intronic
1093220286 12:16412794-16412816 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1093585922 12:20835940-20835962 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1093670694 12:21871543-21871565 CTCAAGAATGAGAAGACTATGGG - Intronic
1093749566 12:22782665-22782687 CTCAGGAAAGAGAAGCCAAGTGG + Intergenic
1094188670 12:27673804-27673826 CTGAAGAAAGAGACATCTGATGG + Exonic
1094397462 12:30024009-30024031 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1095213826 12:39525950-39525972 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1095628732 12:44348783-44348805 CTCAAGACATAGAAGTGTGAGGG + Intronic
1096790387 12:54040793-54040815 TTCCAGAAAGAGAAATCAAAAGG - Intronic
1097163399 12:57066970-57066992 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1097735698 12:63178731-63178753 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1097974846 12:65673399-65673421 AACAAGAAAGAGAAATCCAAGGG + Intergenic
1098472830 12:70865248-70865270 ATAAAGAAAAAGAGGTCTAATGG - Intronic
1098537250 12:71606937-71606959 CTCAATACAGAGAAGAGTAAAGG - Intergenic
1098997584 12:77138699-77138721 TTGAAGAAAGAGAGGTCAAAAGG + Intergenic
1099272202 12:80524431-80524453 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1099791423 12:87339800-87339822 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1100720946 12:97357544-97357566 GTCAAGAAAGACATCTCTAAGGG - Intergenic
1100924137 12:99524638-99524660 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1101538157 12:105639690-105639712 GTAAAGAAAAAGAAGTTTAATGG + Intergenic
1102401334 12:112632232-112632254 CAAAAGAAAGAGAGGTTTAATGG - Intronic
1103025975 12:117574408-117574430 ATAAAGAAAAAGAAGTTTAACGG + Intronic
1103031602 12:117618804-117618826 CTAAAGAAAAAGAGGTTTAATGG - Intronic
1105571606 13:21608632-21608654 CTAAAAAAAGACAAGTATAATGG - Intergenic
1106380876 13:29237678-29237700 ATCAAGAAAGAGAAATCTCCAGG - Intronic
1107060222 13:36152271-36152293 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1107284931 13:38780310-38780332 CGCAAGAAACAGAAGAATAAAGG - Intronic
1108167779 13:47710739-47710761 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1108897260 13:55347853-55347875 TTCAAGAAAGAGAATTTTAAAGG + Intergenic
1108915329 13:55603689-55603711 ATGAAGAAAGAGATGTCAAATGG - Intergenic
1109032614 13:57211739-57211761 CTTAAGAAAGAAAAGCCTAGGGG + Intergenic
1109102237 13:58199773-58199795 ATGAAGAAAAAGAAGTTTAATGG - Intergenic
1109702573 13:66046983-66047005 ATAAAGAAAAAGAAGTGTAATGG + Intergenic
1109957472 13:69587080-69587102 TTGAAGAAAGAGAACTATAAAGG + Intergenic
1110121654 13:71889018-71889040 ATCAAGAAAGCAAAGTCAAATGG - Intergenic
1110962811 13:81651449-81651471 ATAAAGAAATAGAAGTTTAATGG + Intergenic
1111172275 13:84543072-84543094 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1111459593 13:88521245-88521267 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1111722703 13:91967042-91967064 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1111724547 13:91989292-91989314 ATTTAGAAACAGAAGTCTAAAGG - Intronic
1111986471 13:95071178-95071200 CAGAAGAAAGAGAGGTTTAATGG - Intronic
1113034596 13:106035503-106035525 CTAAAGAAAGAGAATGCAAATGG + Intergenic
1113089855 13:106605950-106605972 CTCACGATAGAAAAGCCTAAAGG - Intergenic
1113884198 13:113649369-113649391 CTCAAGATTGAGAAGTGAAACGG - Exonic
1114525326 14:23364497-23364519 ATCAAGAAAGAGAAGACAGAGGG - Intronic
1114928889 14:27442465-27442487 CAGAAGAAAGTGAAGTCCAAAGG - Intergenic
1115134613 14:30094124-30094146 CTAAAGAAAAAGAGGTTTAATGG + Intronic
1115817520 14:37178849-37178871 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1116230742 14:42213182-42213204 CTCTAGAAATAGAGGTCTATAGG - Intergenic
1116931633 14:50696501-50696523 TTCAAGAAAAAAAAGTCTAAAGG - Intergenic
1117205573 14:53439617-53439639 CTAAAGAAAAAGAGGTTTAATGG + Intergenic
1117445080 14:55796574-55796596 ATAAAGAAAAAGAGGTCTAATGG + Intergenic
1117748493 14:58896498-58896520 ATCAAGAAAAAGAATTTTAAAGG - Intergenic
1117871936 14:60210406-60210428 ATGAAGAAAAAGAAGTTTAATGG + Intergenic
1118047102 14:61982325-61982347 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1118787389 14:69057264-69057286 CTCTGCAAAGAGATGTCTAAGGG + Intronic
1119142852 14:72283636-72283658 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1119643783 14:76334314-76334336 CTCTGGAGAGAGAACTCTAAGGG + Intronic
1121840876 14:97132775-97132797 ATAAAGAAAAAGAAGTTTAACGG + Intergenic
1122817977 14:104323266-104323288 CTCAAGGAAGAGCACGCTAAGGG - Intergenic
1122966419 14:105129524-105129546 CTCAAGAAACAGAAGTCGCAAGG - Intergenic
1124388831 15:29234657-29234679 CACAAGAGAGAAAAGTGTAAGGG + Intronic
1124664876 15:31583703-31583725 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1124714188 15:32043829-32043851 CTCAAGAAAGAGAAGTCTAAAGG - Intronic
1128710494 15:69867841-69867863 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1129569497 15:76665279-76665301 ATCAACAAATAGAAGTCTACTGG - Intronic
1130015804 15:80185558-80185580 ATAAAGAAAGAGAGGTTTAATGG + Intronic
1130016364 15:80189521-80189543 CTCAGGACAGAGAAGTCCCATGG - Intergenic
1130345483 15:83040722-83040744 CAAAAGAAAGAAAAGTCTCATGG - Intronic
1130575805 15:85092376-85092398 CTCTAGAAAGAGAGGTATGAAGG + Intronic
1130607935 15:85334551-85334573 CTCAAGAAAGAGCAGTCCAGTGG - Intergenic
1131410571 15:92204117-92204139 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1131449815 15:92529831-92529853 CAAAAGAAAGAGAGGTTTAATGG - Intergenic
1131458400 15:92601321-92601343 CTCTGGAAGGAGAATTCTAAAGG - Intergenic
1131560663 15:93436739-93436761 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1131635402 15:94228303-94228325 TTCAAGAAAGTGAAGCCTACAGG + Intergenic
1131795914 15:96016569-96016591 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1132029693 15:98429729-98429751 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1133470418 16:6069564-6069586 CTCCAGAAAGAAGAGTCTAAAGG - Intronic
1134333673 16:13273585-13273607 CAAAAGAAAGAGAGGTTTAATGG - Intergenic
1134380693 16:13722109-13722131 GTAAAGAAAAAGAAGTTTAATGG - Intergenic
1134564554 16:15239956-15239978 GTAAAGAAAAAGAAGTTTAATGG + Intergenic
1134737941 16:16516743-16516765 GTAAAGAAAAAGAAGTTTAATGG - Intergenic
1134757570 16:16681746-16681768 CTCAAGAAACAAAAATCTAAGGG + Intergenic
1134790692 16:16986769-16986791 CTCAAAAAAGTTAAGTCAAAAGG + Intergenic
1134988498 16:18677420-18677442 CTCAAGAAACAAAAATCTAAGGG - Intergenic
1135346708 16:21694923-21694945 ATAAAGACAGAGAAGTCTGAAGG - Intronic
1135798071 16:25464848-25464870 TTCTAGAAATAGAAGTCAAATGG + Intergenic
1137592646 16:49703217-49703239 TTCAAGAAAGAAATTTCTAAAGG - Intronic
1139015094 16:62680003-62680025 TTCAAGAAAGAAAAGGCTGAGGG + Intergenic
1139564979 16:67768888-67768910 CACAAGAAAGAAAATTCCAAAGG + Intronic
1140018517 16:71213161-71213183 CTCAATAAAGAAAAATCTAAAGG + Intronic
1140247765 16:73266879-73266901 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1140469988 16:75208507-75208529 CTCAAGAAAGAGGAATGTAGGGG - Intergenic
1140617383 16:76682796-76682818 CTGAAGTAAGAGAAGTCTTATGG - Intergenic
1140746598 16:77986123-77986145 CTCAAGTAAGAGAAGACCATGGG + Intergenic
1140761136 16:78109749-78109771 CACAAGAAAGACAGGTCTACAGG - Intronic
1140880414 16:79193114-79193136 CACAAGAGAATGAAGTCTAATGG - Intronic
1141312794 16:82931612-82931634 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1141322574 16:83025708-83025730 CCCAAGAAAGGGAAGTTTTAAGG - Intronic
1142899338 17:3002659-3002681 CTGAAGAAAGAAGAGTATAAAGG + Intronic
1142917949 17:3158532-3158554 CTAAAGAAAGAAGAGACTAAAGG + Intergenic
1143364582 17:6397882-6397904 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143743586 17:8973089-8973111 CTCCAAAAAAAGAAGCCTAAGGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1145944767 17:28765203-28765225 CTCAAAGAAATGAAGTCTAAAGG + Intronic
1149542531 17:57478471-57478493 CTCAAGAAAGGAAAGTCCACAGG + Intronic
1151084280 17:71363237-71363259 ATAAAGAAAGAGATGTTTAATGG + Intergenic
1151138240 17:71968025-71968047 ATAAAGAAAAAGAGGTCTAATGG - Intergenic
1151400712 17:73854144-73854166 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1151572020 17:74931225-74931247 GGCAAGACAGAGAAGGCTAAGGG - Intronic
1152552411 17:81036149-81036171 CTGAAGAAAGAGAAAACCAAGGG - Intronic
1154045206 18:10897622-10897644 ATAAAGAAAGAGAGGTTTAATGG - Intronic
1154511495 18:15108037-15108059 ATCAACAAATAGAAGTATAAAGG + Intergenic
1155022022 18:21905351-21905373 CTCATGAATGAGAAGTGAAATGG + Intergenic
1155098605 18:22585538-22585560 CTGAAGAAACAGAAGTCTAAGGG + Intergenic
1155267490 18:24107679-24107701 ATCGAAAAAGAGAAGTTTAATGG - Intronic
1155798025 18:30064915-30064937 CTAAAGAAAAAGAGGTTTAATGG + Intergenic
1156176072 18:34548065-34548087 CTCAAGAAACAGAAGGTAAAAGG - Intronic
1156359423 18:36371316-36371338 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1156365430 18:36421856-36421878 CTGAAGAAAGAGACCTGTAAAGG + Intronic
1158218661 18:55127406-55127428 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1158312099 18:56170273-56170295 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1158488824 18:57891931-57891953 CTCATGAAAAAAAAATCTAAAGG - Intergenic
1158879960 18:61768575-61768597 ATAAAGAAAAAGAGGTCTAATGG - Intergenic
1158983093 18:62784486-62784508 CAGAAGGAAGAGAAGTTTAAGGG + Intronic
1159215442 18:65386027-65386049 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1159439199 18:68455832-68455854 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1159763335 18:72455744-72455766 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1160599236 18:80000013-80000035 ATCAAGAAAAAGAGGTTTAATGG - Intronic
1161900060 19:7111763-7111785 CTCAAGAAAGACTATTCAAAAGG + Intergenic
1163076967 19:14902210-14902232 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1164530489 19:29044587-29044609 CTAAAGAAAAAGAGGTTTAATGG + Intergenic
1164892867 19:31839892-31839914 CTGAAGAAAAAGAGGTTTAATGG + Intergenic
1165024091 19:32946839-32946861 ATCAAGAAAAAGAAGTTTAATGG - Intronic
1165290517 19:34880632-34880654 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1165344757 19:35237865-35237887 CTAAAGAAAAAGATGTTTAATGG - Intergenic
1165405230 19:35626613-35626635 TTCAATAAAGAGAAGGCAAAAGG + Intergenic
1166265065 19:41676298-41676320 AAGAAGAAAGAGAAATCTAATGG - Intronic
1167701586 19:51050976-51050998 CTTCAGAAAGACAAATCTAAAGG - Intergenic
1167872947 19:52388842-52388864 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1168237384 19:55071863-55071885 CCAAAGAAAGAGAAGCGTAAGGG + Intergenic
926459695 2:13113452-13113474 CTCAAGAAGAAGAAAGCTAAAGG - Intergenic
926970825 2:18465735-18465757 GTAAAGAAAGAGAGGTTTAATGG + Intergenic
926979233 2:18549486-18549508 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
927695255 2:25235483-25235505 CCCAAGTAAGAGGAGTCTAGGGG - Intronic
928453575 2:31399841-31399863 ACAAAGAAAGAGAAGTTTAATGG - Intronic
929070933 2:38029826-38029848 ATAAAGAAAAAGAAGTTTAATGG + Intronic
929464486 2:42132505-42132527 CTCAAGAAACAGAACTCCACAGG - Intergenic
929702824 2:44179250-44179272 CAAAAGAAAGAGAGGTTTAATGG - Intronic
929755984 2:44765225-44765247 CTCAAAAAAAAAATGTCTAAAGG + Intronic
929815530 2:45228171-45228193 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
930379867 2:50614181-50614203 CTCAACAAGGAAAAGTCTAGAGG + Intronic
931083613 2:58804184-58804206 GTAAAGAAAAAGAAGTTTAATGG + Intergenic
931341355 2:61404210-61404232 ATGAAGAAAGAGAGGTATAAAGG + Intronic
932281508 2:70496826-70496848 CTCAAGGAACTTAAGTCTAATGG + Intronic
936628133 2:114170602-114170624 ATCAGGAAAGAGAAGACTTAGGG - Intergenic
937297693 2:120819650-120819672 CTCAAGAACCAGAAATCTGAAGG + Intronic
937966261 2:127514035-127514057 CTCAGGAAAGAGCAGGCAAACGG - Intronic
938693040 2:133809852-133809874 CATAAGAAAGAGGAGTCAAATGG + Intergenic
939226952 2:139376810-139376832 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
939366459 2:141239066-141239088 ATCAATAAAAAGATGTCTAAAGG + Intronic
939756536 2:146119273-146119295 CAGAAGAAAGAGAAGTTTAGTGG + Intergenic
939860972 2:147420070-147420092 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
940400165 2:153240136-153240158 CTCACAAAACAGAAGTTTAAAGG - Intergenic
940631943 2:156251093-156251115 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
940980561 2:159997628-159997650 CTCAACACAGACAACTCTAAGGG - Intronic
941338509 2:164275310-164275332 ATCAAGAAAGAAAAATGTAATGG - Intergenic
942601218 2:177643042-177643064 CAAAAGAAAGAGAGGTTTAAGGG - Intronic
943108261 2:183573108-183573130 CAAAAGAAAGAGAGGTTTAATGG - Intergenic
943215894 2:185034041-185034063 TTCAAGAATAAGGAGTCTAATGG + Intergenic
944907561 2:204277843-204277865 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
945140370 2:206680104-206680126 ATAAAGAAAAAGAAGTTTAATGG + Intronic
945664578 2:212724667-212724689 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
946562066 2:220925239-220925261 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
946629625 2:221652952-221652974 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
947161228 2:227217042-227217064 ATAAAGAAAAAGAAGTTTAATGG + Intronic
948020803 2:234731699-234731721 CTCATGAAAGAGATGCCCAATGG - Intergenic
948038223 2:234876905-234876927 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
948841864 2:240655031-240655053 CAAAAGAAAGAGAGGTTTAATGG + Intergenic
949024719 2:241761536-241761558 CTCAAGAAAGAAAAGTATACAGG + Intronic
1168734578 20:119884-119906 CTCATGAAAGGAAATTCTAAAGG - Intergenic
1169649171 20:7847761-7847783 CTTTGGAAAGAGTAGTCTAAAGG - Intergenic
1170338289 20:15295249-15295271 CTAAAGAAAAAGAGGTTTAATGG - Intronic
1170348667 20:15416326-15416348 ACCAAGAAAGAGATGTCTAAAGG - Intronic
1172324452 20:34023673-34023695 CTCTAGAAAGTGAAGCCTTATGG + Intronic
1172493929 20:35364390-35364412 TTCAAGAAATGTAAGTCTAATGG - Intronic
1173081188 20:39869209-39869231 GTCAAGAAAGAGAAGAATATTGG + Intergenic
1173424938 20:42934342-42934364 ACAAAGAAAAAGAAGTCTAATGG + Intronic
1173752841 20:45490216-45490238 CTCAAGAAATAAAATGCTAATGG + Intergenic
1174713221 20:52728837-52728859 CTCAAAAAAGAAATGTCTCAGGG + Intergenic
1174729074 20:52896806-52896828 GTAAAGAAAAAGAAGTTTAATGG + Intergenic
1174833196 20:53832790-53832812 GTAAAGAAAAAGAAGTTTAACGG + Intergenic
1174881594 20:54285120-54285142 CTCCTGAAAGAGCAGTCTCAGGG - Intergenic
1174927929 20:54781502-54781524 TTTAAGAAAGAGAATTCTAGTGG + Intergenic
1175178906 20:57131049-57131071 TGCAAGAAATATAAGTCTAATGG - Intergenic
1175543124 20:59760635-59760657 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1177385976 21:20410030-20410052 GTAAAGAAAAAGAAGTTTAATGG + Intergenic
1177474483 21:21602027-21602049 CTCAAGTGAGTAAAGTCTAAAGG + Intergenic
1177480855 21:21686220-21686242 ATAAAGAAATAGAAGTTTAACGG + Intergenic
1177502094 21:21969791-21969813 TTCTTGAAATAGAAGTCTAAAGG + Intergenic
1177571966 21:22898810-22898832 CTCAAGAAAAAGATGTCTGGAGG + Intergenic
1177635090 21:23776998-23777020 CTTTAAAAAGAGAAATCTAAAGG - Intergenic
1177770743 21:25512842-25512864 CCCAAGAAAGAGAAGTGAAAAGG + Intergenic
1177987560 21:27996586-27996608 TTCAAGAAAGTAAAGTGTAATGG - Intergenic
1178037260 21:28599275-28599297 ATTAAGAAAAAGAAGTTTAATGG + Intergenic
1178136997 21:29638747-29638769 TTCAAGAAAAGGAAGTCTATTGG - Intronic
1178971117 21:37177689-37177711 CTCAAGAAAGTGATGCCCAAAGG - Intronic
1179300611 21:40106030-40106052 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1179986546 21:44924934-44924956 CTGAAGACAGAGAAGGCTACGGG + Intronic
1181758020 22:25039132-25039154 CTGAAGAAAGAGAACTCCAGAGG + Exonic
1182418563 22:30237099-30237121 ATCAAAAAAGAGGAGTCTCAGGG - Intergenic
1183679662 22:39320316-39320338 CTCAAAAAAGAGATTTGTAAGGG - Intronic
1183795274 22:40112097-40112119 CTCAAAAAAGAGAAAGCAAAAGG + Intronic
1184160499 22:42694585-42694607 ACCAGGAAAGAGAGGTCTAATGG - Exonic
1184377774 22:44125356-44125378 GTGAAGAAAGAGAAGTATTATGG + Intronic
1184586392 22:45450988-45451010 CTGCAGAAAGAGATGTCAAATGG + Intergenic
949761916 3:7480319-7480341 CTTAGGAAAAAGAAGTCTTAAGG + Intronic
949871724 3:8594985-8595007 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
951109430 3:18784727-18784749 CCCGAAAAAGGGAAGTCTAATGG - Intergenic
951150422 3:19283044-19283066 CTAAAGAGAGAGAAGACAAAGGG + Intronic
951230172 3:20169371-20169393 CTCAAAAAAGAGAATACCAAGGG + Intronic
951360381 3:21717830-21717852 ATAAAGAAAAAGAAGTTTAATGG - Intronic
951455095 3:22882922-22882944 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
951577250 3:24126562-24126584 CTCAAAAAAAAGAAGTCCACAGG + Intronic
952259844 3:31729416-31729438 TCCAAAAAAGAAAAGTCTAAGGG - Intronic
952477454 3:33725552-33725574 CCCAAGAATGAGAAGTCTGGAGG + Intergenic
952674029 3:36005091-36005113 CATGATAAAGAGAAGTCTAATGG - Intergenic
955513954 3:59708335-59708357 CTAAAGAAAAAGAGGTTTAATGG + Intergenic
955620992 3:60863963-60863985 ATAAAGAAAAAGAAGTTTAATGG + Intronic
955905833 3:63806748-63806770 CTGAAGAAAGTGATGTCTAAGGG - Intergenic
956319360 3:67979290-67979312 CTCAAGTTAGAAAGGTCTAATGG - Intergenic
956353547 3:68365652-68365674 ATAAAGAAAGAGATGTTTAATGG + Intronic
956546762 3:70411819-70411841 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
956586573 3:70871503-70871525 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
957294261 3:78316458-78316480 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
957725896 3:84066942-84066964 ATCAAGAAAGAGAATTGCAATGG + Intergenic
957968745 3:87355887-87355909 ATAAAGAAAGAGAGGTTTAATGG + Intergenic
959306546 3:104674066-104674088 CACATGAAAGAGAAGGCGAAAGG - Intergenic
959430123 3:106243763-106243785 CCCAAGAAAGAGGAGATTAAAGG - Intergenic
960139462 3:114138344-114138366 ATAAAGAAAAAGAAGTTTAATGG + Intronic
960928586 3:122821182-122821204 ATAAAGAAAAAGAAGTTTAATGG - Intronic
961588284 3:127953980-127954002 CTCAGGAAAAAAAAGTCAAAAGG - Intronic
962517351 3:136164873-136164895 CTCAAAAAAAAAAAGTCTGAAGG - Intronic
962549578 3:136476012-136476034 ATGAAAAAAGTGAAGTCTAAAGG + Intronic
964919790 3:161883049-161883071 CTGAAGAAAGAGGAGTCTTGTGG - Intergenic
965177692 3:165356857-165356879 TTAAAGAAAGAAAAGTCTAATGG + Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
965236314 3:166128431-166128453 CTTAAGTAAGAGAACTTTAAAGG + Intergenic
965355811 3:167671688-167671710 CTGAAGCAAAAGAAGTCTAAAGG + Intergenic
965635464 3:170775976-170775998 CTCAAGAAAGAGTAGTTCAGTGG - Intronic
967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG + Intronic
969244165 4:5921805-5921827 CTAAAGAAAGAGCAGTCTGACGG + Intronic
970229325 4:13892400-13892422 CTGAAGAAAGAGAAGTATCTGGG - Intergenic
970663613 4:18312620-18312642 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
970859373 4:20684122-20684144 CTGAAGATAAAGAAGGCTAAGGG + Intergenic
970989491 4:22195915-22195937 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
971338501 4:25745949-25745971 CATAAGAAAGAGCAGTCTGAGGG - Intergenic
971484693 4:27147339-27147361 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
971608955 4:28696567-28696589 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
972227536 4:37030600-37030622 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
972656237 4:41066456-41066478 CTAAGGAAAGTGAAGTCTAGGGG + Intronic
973960624 4:56106256-56106278 CTCATGCAGGGGAAGTCTAAAGG - Intergenic
974253145 4:59414908-59414930 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
974344844 4:60666021-60666043 ATTTAGAAAGAAAAGTCTAATGG - Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
974746459 4:66084392-66084414 ATCAAGAAAAAGAGGTTTAACGG - Intergenic
975849923 4:78561533-78561555 ATCAGGAAAGAAAGGTCTAATGG - Intronic
975970675 4:80031821-80031843 CTAAAGAAAGAGAAGTGAAAGGG + Intronic
976051421 4:81015592-81015614 CAAAAGAAAGAGAGGTTTAATGG + Intergenic
976335366 4:83879166-83879188 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
976727143 4:88225776-88225798 ATCAAGAAAAAGAGGTTTAATGG + Intronic
976836483 4:89380459-89380481 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
977070412 4:92377634-92377656 GTGAAGAAAAAGAAGTTTAATGG + Intronic
977090313 4:92666077-92666099 CTGAAGAAAGTGAAAACTAAAGG - Intronic
977184065 4:93915211-93915233 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
977503786 4:97877439-97877461 ATAAAGAAAAAGAAGTTTAACGG + Intronic
977537649 4:98274291-98274313 CTTATGACACAGAAGTCTAATGG - Intronic
977545241 4:98368964-98368986 ATAAAGAAAAAGAAGTTTAATGG + Intronic
978175010 4:105719231-105719253 CTCAAGCAACAGAAGGCTGATGG + Exonic
978725435 4:111964063-111964085 CTGAGGAAAGATAATTCTAAGGG - Intergenic
978802902 4:112772153-112772175 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
979373918 4:119921767-119921789 CTGAAGAAAGAAAAGCCTGAAGG - Intergenic
979590270 4:122470949-122470971 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
979784357 4:124697063-124697085 ATTAAAAAAGAGAAGACTAAGGG + Intronic
979840708 4:125436589-125436611 ATAAAGAAAAAGAAGTTTAATGG + Intronic
980509739 4:133770771-133770793 TGGAAGAAAGAGAAGTTTAATGG + Intergenic
980582690 4:134774099-134774121 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
980905842 4:138947992-138948014 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
981026956 4:140086287-140086309 TTCAAGGAAGAGAAGTTTCAGGG - Intronic
981693290 4:147532751-147532773 CTCAAGATGGTGAAGTCTAACGG - Intronic
982408907 4:155050509-155050531 TTCAAGGAAGAGTACTCTAAAGG + Intergenic
982460313 4:155662239-155662261 TTCAAGAAAAAGAGGTTTAAGGG + Intergenic
982569009 4:157025347-157025369 CTAAAGAAAAAGAGGTTTAATGG + Intergenic
982968782 4:161951218-161951240 ATCAAGAAAAAGAGGTTTAATGG - Intronic
982995779 4:162343030-162343052 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
983602980 4:169550318-169550340 ATAAAGAAAAAGAGGTCTAATGG - Intronic
983775514 4:171601918-171601940 ATCAAGTAAGTGAAGTCTGATGG + Intergenic
984010354 4:174363858-174363880 CAAAAGAAAGAGAGGTTTAATGG + Intergenic
984213314 4:176877260-176877282 ATCAAGAAAAAGAGGTTTAATGG + Intergenic
984601096 4:181727734-181727756 AACCAGAAAGAGAAGTCTCAAGG - Intergenic
986223262 5:5789403-5789425 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
986867486 5:12007338-12007360 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
986878820 5:12144396-12144418 TACAAAAAAGAGAAGTTTAATGG - Intergenic
987160809 5:15140230-15140252 CTCCTGAAGGAGAAGTCTCAGGG - Intergenic
987172219 5:15270651-15270673 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
987338965 5:16922469-16922491 CTCTAGAAAATGAAGTGTAAGGG + Intronic
987896992 5:23959733-23959755 CTAAAGAAAAAGAGGTTTAATGG + Intronic
988653354 5:33178548-33178570 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
988878269 5:35472190-35472212 CTTAAGGAAGAGAAGTCTAAGGG - Intergenic
989284265 5:39681045-39681067 CACAAGAAAAAGAAATCAAAAGG + Intergenic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989782870 5:45290233-45290255 ATAAAGAAAGAGAGGTTTAATGG - Intronic
990577076 5:57133768-57133790 CTGAAGCAAGAGAAGTCCAAAGG - Intergenic
991069643 5:62462764-62462786 CTCAAGAAAGAAAACATTAAGGG - Intronic
991992980 5:72359860-72359882 CTTAAGAAACAGAATACTAAGGG + Intronic
992464917 5:76994260-76994282 CTAAAGAAAGACAAGTCTATAGG + Intergenic
993414925 5:87615330-87615352 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
994856475 5:105127483-105127505 GTCAAAATAAAGAAGTCTAAAGG + Intergenic
995039035 5:107567610-107567632 CCCAAGAAAGGGAAGACAAAAGG + Intronic
995187108 5:109283079-109283101 TTCCTGAGAGAGAAGTCTAAAGG + Intergenic
995403168 5:111764361-111764383 CAAAAGAAAGAGAGGTTTAATGG + Intronic
995703439 5:114961014-114961036 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
996268250 5:121569718-121569740 CAAAAGAAAGAGATGTTTAATGG - Intergenic
996371988 5:122763376-122763398 CTTAACTAAGAGAAGGCTAAGGG + Intergenic
996420924 5:123261541-123261563 GGCAAGAAAGACAAGTCAAAGGG + Intergenic
996622198 5:125520649-125520671 ATCAAGAAAAAGAGGTTTAATGG + Intergenic
996689616 5:126325774-126325796 CTCAAAAAAGAGAAGTACCAAGG + Intergenic
996744138 5:126831229-126831251 CTCAAGAAAGAGAATGCTACAGG - Intronic
996872765 5:128209869-128209891 CTCAAAAAAGAAAATCCTAAAGG + Intergenic
997057196 5:130458983-130459005 CAAAAGAAAGAGAGGTTTAATGG - Intergenic
997300823 5:132803017-132803039 ATAAAGAAAAAGAAGTTTAATGG - Intronic
997307290 5:132847634-132847656 CTCAAAAAAAAAAAGTATAATGG - Intergenic
997996033 5:138587194-138587216 CTCAAGAAAAGAAAGTGTAAGGG + Intergenic
998042200 5:138958168-138958190 GTCATGAAAGACAAGACTAAGGG - Intronic
999032635 5:148311255-148311277 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
999187811 5:149725896-149725918 CTAAAGAAACAAAAGTTTAAAGG - Intergenic
999710663 5:154315559-154315581 CTCAAGAAAGAGAATTTGATTGG + Intronic
1000230289 5:159309736-159309758 CTCAATAAAGAGGAGTTTCAGGG + Intergenic
1000570589 5:162908665-162908687 CTGAATAAAGAGAATTCTGATGG + Intergenic
1001259166 5:170212393-170212415 CTGAAGAAAGAAAACTCTAAGGG - Intergenic
1001350576 5:170959476-170959498 CAGAAGAAAGAGAAGTGCAAAGG - Intronic
1001613273 5:173021308-173021330 ATAAAGAAAGAGAGGTTTAATGG + Intronic
1002089197 5:176794503-176794525 CTCAAGAAACAGCAGTCTGGTGG - Intergenic
1002848144 6:967253-967275 AACAAGAAAGAGAAGTTTCAGGG + Intergenic
1002987825 6:2208118-2208140 ATCATGTAAGAGAAGTCTGATGG + Intronic
1003287634 6:4748444-4748466 CTTGAGAAAGAGAATTCTGAGGG + Intronic
1003897831 6:10624264-10624286 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1003986823 6:11443674-11443696 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1005560100 6:27030956-27030978 CTAAAGAAAGAGAATTTAAAGGG - Intergenic
1005801032 6:29424913-29424935 CTCAAGTAAAAGAAGTCTGGAGG - Intronic
1006643510 6:35500605-35500627 CTCAAGAAAGAAAGATCTTAAGG - Intronic
1006983751 6:38164704-38164726 CTCAAGCAAGAGGAGGCTGAGGG - Intergenic
1007969736 6:46038562-46038584 CTTAAGAAAGGGAAGTTTACTGG + Intronic
1008331456 6:50249954-50249976 TTCAAGGAAGAAAAGTCTTAAGG + Intergenic
1008755952 6:54795960-54795982 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1008906815 6:56686821-56686843 CTCCAGAAACAGAAGACAAAAGG + Intronic
1009285850 6:61816073-61816095 TTTAACAAATAGAAGTCTAAGGG - Intronic
1009370959 6:62902864-62902886 CTCCAGAAAGTGACTTCTAAAGG + Intergenic
1009406127 6:63314807-63314829 CTCAAGAAAGAAAAATATCAAGG + Intronic
1009631819 6:66209761-66209783 ATAAAGAAAGAGAGGTTTAATGG + Intergenic
1009982236 6:70740803-70740825 CTAAAGAAAAAGAGGTTTAATGG + Intronic
1010174133 6:73007019-73007041 GGCAAGCAAGAGATGTCTAAAGG - Intronic
1010327395 6:74580867-74580889 CTCAAGGAAGAGCAGTCTCATGG + Intergenic
1010501554 6:76607917-76607939 CTAAAGAAAGTTAAGTATAATGG - Intergenic
1011049641 6:83130635-83130657 ATAAAGAAAGAGAAGTATTAGGG + Intronic
1012042128 6:94220501-94220523 CTCAAGAATGAGAAGAGTGATGG + Intergenic
1012136551 6:95564413-95564435 ACCAAGAAAGAGAAGTCTACAGG + Intergenic
1012202656 6:96425070-96425092 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1012357820 6:98338097-98338119 CTCCAGGAAGAGAAGGTTAATGG - Intergenic
1012706713 6:102539967-102539989 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1012897970 6:104973484-104973506 CTAAAGAAAGAGACGACTTAAGG - Intronic
1012918019 6:105191447-105191469 GTAAAGAAATTGAAGTCTAAAGG + Intergenic
1014359444 6:120458681-120458703 CTCAAGAAAGAGAAATCTCTAGG - Intergenic
1014381397 6:120747447-120747469 CTCAAATGAGAGAAGTCTCAAGG + Intergenic
1015129062 6:129789455-129789477 ATAAAGAAATAGAAGTTTAATGG - Intergenic
1015369356 6:132433661-132433683 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1016269320 6:142270121-142270143 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1017346641 6:153390916-153390938 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1017524360 6:155229754-155229776 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1018005129 6:159614758-159614780 ATAAAGAAAAAGAGGTCTAATGG + Intergenic
1018234855 6:161714027-161714049 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1018396753 6:163383705-163383727 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1019207491 6:170374904-170374926 CTCAAGAAATTAAAGTATAATGG - Intronic
1019798567 7:3070886-3070908 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1021026622 7:15675904-15675926 CTAAAACAAGAGAAGTTTAAAGG - Intronic
1021775735 7:24053564-24053586 CTGAAGAAAGAGATGGGTAAAGG - Intergenic
1021777763 7:24070448-24070470 CTCTAGTAAAAGAAGTCTAGAGG - Intergenic
1022256904 7:28667352-28667374 CTCAAGACAGAAATTTCTAAGGG - Intronic
1023142136 7:37112314-37112336 CTAATGAAAGAGGAGCCTAAAGG + Intronic
1023218461 7:37892589-37892611 ATAAAGAAAGAGAAGTCAATAGG - Intronic
1023341817 7:39229201-39229223 CTCAAGAAAGAGAAAACAATAGG + Intronic
1023636073 7:42211954-42211976 CTCAAGAAAGAAAAGTTGAATGG - Intronic
1023805967 7:43873194-43873216 CTCAAGAAAGAGAAGACCGAGGG + Intronic
1024369428 7:48563346-48563368 CTGAAGAAAGAGAGGGTTAAAGG + Intronic
1024513426 7:50221065-50221087 CTCAAGATAGAGGAGCCCAAAGG + Intergenic
1024735366 7:52299011-52299033 CTAATGAAATAGAAGTCTAAAGG + Intergenic
1026225649 7:68437722-68437744 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1026509095 7:71013067-71013089 GTCAAAAAAGAGATGTCTTAAGG + Intergenic
1026566433 7:71493434-71493456 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1027982517 7:85244103-85244125 CTCATGGATGATAAGTCTAAGGG + Intergenic
1028125994 7:87114173-87114195 GTGAAGAAAAAGAAGTTTAATGG - Intergenic
1028367302 7:90048571-90048593 CTAAAGAAAAAGAGGCCTAATGG - Intergenic
1030144529 7:106340285-106340307 CAAAAGAAAGAGAGGTTTAATGG + Intergenic
1030790770 7:113725222-113725244 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1031180406 7:118407470-118407492 ATAAAGAAAAAGAGGTCTAATGG + Intergenic
1031692359 7:124804694-124804716 CTGAAGACAGTGAAGTATAATGG - Intergenic
1032100545 7:128973083-128973105 ATCAAGAAAGACCAGTCAAAAGG + Intronic
1032123480 7:129173711-129173733 ATGAAGAAAGAGAAGGCAAAGGG + Intergenic
1032796315 7:135279140-135279162 ATCAAGAAAAAGAAGTTTAATGG - Intergenic
1033958281 7:146879844-146879866 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1035840633 8:2809183-2809205 GTAAAGAAAGAGAGGTCTAATGG + Intergenic
1036134395 8:6146529-6146551 CACAAAAAAGAGAAGTAAAAGGG + Intergenic
1036566347 8:9941479-9941501 CTAAAGAAAAAGAGGTTTAATGG - Intergenic
1036577955 8:10046046-10046068 CCCAAGAAAGATAAGATTAAGGG + Intergenic
1036923984 8:12885949-12885971 ATAAAGAAAAAGAAGTTTAACGG - Intergenic
1037745906 8:21643918-21643940 CTCAAGATAGAGAAGCCAAAAGG + Intergenic
1038376104 8:27041975-27041997 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1039734464 8:40315788-40315810 ATAAAGAAAAAGAAGTTTAACGG + Intergenic
1040655080 8:49498526-49498548 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1040930358 8:52728177-52728199 CTCCAGAAGAAGAAATCTAATGG + Intronic
1041463700 8:58138450-58138472 CTCCAGTCTGAGAAGTCTAAGGG - Intronic
1041569482 8:59321070-59321092 GTCAAGATAGAGAAGTCCCAAGG + Intergenic
1041718523 8:60953960-60953982 CTCATGAAAGAAACATCTAAAGG - Intergenic
1041726336 8:61021189-61021211 CTGAGGAAAGAGAAGGCCAAGGG + Intergenic
1042030241 8:64467677-64467699 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1043218232 8:77622425-77622447 TTAAAGAAAGAAAAGTCTCAGGG + Intergenic
1043331926 8:79127893-79127915 CTCAATAAAGATAAGAATAATGG + Intergenic
1043343014 8:79264647-79264669 ATAAAGAAACAGAAGTCTGAAGG + Intergenic
1043385609 8:79744772-79744794 CTCATGTAAAAGAAGTCCAAAGG + Intergenic
1043680907 8:83023320-83023342 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1044227301 8:89734283-89734305 CAAAAGAAAGAGAAGTTTAATGG + Intergenic
1044565832 8:93660495-93660517 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1044606447 8:94052184-94052206 CTCAAGAAAGGGCAGTCTTGTGG - Intergenic
1044965604 8:97570982-97571004 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1045756122 8:105544597-105544619 CTGAAGAAAAGGAGGTCTAATGG + Intronic
1046537333 8:115532019-115532041 CTGAAGAAAAAGGAGTCGAAGGG + Intronic
1046552024 8:115729882-115729904 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1046606159 8:116374337-116374359 ATCAAGAAAAAGCAGTTTAATGG + Intergenic
1046816011 8:118584374-118584396 CACAAAAAAGAGAAATCAAAAGG - Intronic
1047239699 8:123074561-123074583 ATCAAGAAAGAGAAGGCGAGTGG - Intronic
1047299480 8:123600675-123600697 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1047450193 8:124958559-124958581 TTCCTCAAAGAGAAGTCTAATGG + Intergenic
1047969497 8:130072514-130072536 ATAAAGAAAAAGAAGTTTAATGG - Intronic
1048116857 8:131532902-131532924 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1050120546 9:2303005-2303027 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1050233302 9:3551769-3551791 TTAAAGAAAGTCAAGTCTAAAGG + Intergenic
1050697909 9:8299506-8299528 CACAGGAAAGGGAAGTCTTAAGG + Intergenic
1050935633 9:11391825-11391847 CTAAAGAAAGAAAGGTTTAATGG - Intergenic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1052099029 9:24420963-24420985 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1055379508 9:75690656-75690678 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1055579471 9:77692338-77692360 CAAAAGAAAGAGAGGTTTAATGG + Intergenic
1056009972 9:82318205-82318227 GTCACAAAAGAGAAATCTAAAGG + Intergenic
1057877663 9:98770296-98770318 CTAAAGAAAAAGAGGTTTAATGG - Intronic
1058307855 9:103465034-103465056 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1058377981 9:104346813-104346835 CTCAAATCAGAGCAGTCTAAAGG + Intergenic
1058513799 9:105749277-105749299 ATAAAGAAAAAGAAGTTTAAGGG + Intronic
1058593485 9:106589693-106589715 CTGAAGAAAGAGAGTTCTATGGG + Intergenic
1059184555 9:112255913-112255935 CTCAAGAAAAATAATTCTATAGG - Intronic
1059303168 9:113331827-113331849 CTGAAGAAAGAGAAGGCCCAGGG - Intronic
1059489337 9:114654377-114654399 CTCAGAAAAGAGAAGAATAAAGG - Intergenic
1059558536 9:115307868-115307890 CTCAAGAAAGAGTACTTTACTGG - Intronic
1060789649 9:126477464-126477486 ATAAAGAAAGAGAGGTTTAATGG + Intronic
1061602306 9:131679246-131679268 CTCAGGGAAGACAAGCCTAAGGG + Intronic
1185846997 X:3447072-3447094 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1186138073 X:6540687-6540709 ATCAAGAAAAAGAGGTTTAATGG - Intergenic
1186241417 X:7571172-7571194 ATGAAGAAAAAGAAGTTTAATGG + Intergenic
1187002622 X:15198742-15198764 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1187373310 X:18728272-18728294 ATAAAGAAAAAGAAGTTTAATGG + Intronic
1187949009 X:24453779-24453801 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1188251865 X:27905999-27906021 TTCAAGAAATAGAAATCTTATGG - Intergenic
1188888622 X:35582279-35582301 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1189242210 X:39534052-39534074 CTCAAGGAATAGAAGGCTCAGGG - Intergenic
1189259172 X:39665773-39665795 CTCCAAAACGAGGAGTCTAAGGG + Intergenic
1189740022 X:44108042-44108064 CTAAAGAAAAAGAGGTTTAATGG + Intergenic
1189874563 X:45422157-45422179 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1190707462 X:53042659-53042681 CTCAAGAAATAGAACATTAATGG - Intergenic
1191797199 X:65034247-65034269 TTGCAGAAAGACAAGTCTAAAGG + Intronic
1191979795 X:66913048-66913070 CTGGAGGAAGAGAAGACTAATGG + Intergenic
1193320276 X:80113927-80113949 ATAAAGAAAGAGAGGTTTAATGG - Intergenic
1193969853 X:88038029-88038051 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1194320025 X:92434769-92434791 ATAAAGAAAGAGAAGTTTAATGG + Intronic
1194923064 X:99791864-99791886 ATAAAGAAAAAGAAGTTTAATGG + Intergenic
1195418349 X:104644677-104644699 CTAAAGAAAAAAAAGTCTGATGG + Intronic
1195488708 X:105441009-105441031 CTAAAGAAAAAGAGGTTTAATGG - Intronic
1196024716 X:111029198-111029220 ATCAACAAAGAGAAGCCTATAGG + Intronic
1196348674 X:114700385-114700407 CTGCAGAAAGAGAAGCCTCAAGG + Intronic
1197476898 X:126936376-126936398 TAAAAGAAAGAGAAGTTTAATGG + Intergenic
1197613123 X:128660808-128660830 CTCCTGAAGGAGAAGTCTCAGGG + Intergenic
1197823616 X:130565950-130565972 CTCAAGACAAAGGTGTCTAATGG + Intergenic
1197914774 X:131522722-131522744 CTCAAAAAAAAAAAATCTAAAGG - Intergenic
1198331951 X:135630401-135630423 CTCAAGACGGAGGAGGCTAAGGG - Intergenic
1198796908 X:140406875-140406897 CTAAAGAAAAAGAGGTTTAATGG - Intergenic
1199163651 X:144645432-144645454 ATAAAGAAAAAGAAGTTTAATGG - Intergenic
1199509651 X:148607551-148607573 CTAAAGAAAAAGAGGTTTAATGG - Intronic
1200628145 Y:5547902-5547924 ATAAAGAAAGAGAAGTTTAATGG + Intronic
1201461944 Y:14235372-14235394 ATAAAGAAAAAGAAGTTTAACGG - Intergenic
1201912335 Y:19145480-19145502 TTAAAGAAAAAGAAGTTTAATGG - Intergenic