ID: 1124716120

View in Genome Browser
Species Human (GRCh38)
Location 15:32063892-32063914
Sequence CTGGATCCACAAATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124716120_1124716122 -9 Left 1124716120 15:32063892-32063914 CCATTCTCCATTTGTGGATCCAG 0: 1
1: 0
2: 2
3: 33
4: 278
Right 1124716122 15:32063906-32063928 TGGATCCAGATCCTCTTTCCTGG 0: 1
1: 0
2: 2
3: 8
4: 158
1124716120_1124716127 15 Left 1124716120 15:32063892-32063914 CCATTCTCCATTTGTGGATCCAG 0: 1
1: 0
2: 2
3: 33
4: 278
Right 1124716127 15:32063930-32063952 TTATCTTCTCAGTTGATGGATGG 0: 1
1: 0
2: 1
3: 21
4: 208
1124716120_1124716126 11 Left 1124716120 15:32063892-32063914 CCATTCTCCATTTGTGGATCCAG 0: 1
1: 0
2: 2
3: 33
4: 278
Right 1124716126 15:32063926-32063948 TGGTTTATCTTCTCAGTTGATGG 0: 1
1: 0
2: 2
3: 23
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124716120 Original CRISPR CTGGATCCACAAATGGAGAA TGG (reversed) Intronic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903552072 1:24164541-24164563 CTGGAGCCAAAAGTAGAGAAGGG - Intronic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907888073 1:58612289-58612311 CTGGATCCACAAGGGGATCATGG - Intergenic
909561929 1:77016788-77016810 CTACATCCACAAAAGGGGAAAGG + Intronic
910010369 1:82453702-82453724 CTGAATCAACAAGTGAAGAAAGG + Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
915544050 1:156585965-156585987 CTGGACCTACAAATGGAAGATGG - Exonic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918338889 1:183550840-183550862 ATGGGTCCAAAATTGGAGAATGG - Exonic
921539711 1:216398808-216398830 CTGTTTCAACAAGTGGAGAATGG - Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923653047 1:235891688-235891710 TTGGATCCTGAAATGGAAAAAGG + Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068863687 10:61872178-61872200 CTGTATCCTCACATGGGGAAAGG + Intergenic
1071518831 10:86316495-86316517 CTGGGTCCAGCACTGGAGAAAGG - Intronic
1071752517 10:88496499-88496521 CTTGAACCAGAATTGGAGAAAGG + Intronic
1072541568 10:96402300-96402322 CTAGTACCACAAATGTAGAAAGG - Intronic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075973309 10:126673252-126673274 CTGGATGGACAATTGGAGATGGG + Intergenic
1076197803 10:128532696-128532718 GTGGATCCACAAACAGAGGAGGG + Intergenic
1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG + Intergenic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077466750 11:2737058-2737080 CTGGACCCACTAATGGAAAGTGG - Intronic
1077553186 11:3212939-3212961 CTGGATCAACTTATGGAGAACGG - Intergenic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078018985 11:7639956-7639978 CACAATCCACAATTGGAGAATGG + Intronic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1085429689 11:76437333-76437355 ATGAACCCAGAAATGGAGAAAGG - Intergenic
1085643501 11:78208113-78208135 CAGCAGCCACAAATGGAGACAGG - Intronic
1085814355 11:79720710-79720732 CTGGATGCATAAATGCAGATTGG - Intergenic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1089192557 11:116663654-116663676 CTGCATCCACAAAATAAGAATGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091571234 12:1688450-1688472 CTGGAGCCACAACTGGATTATGG + Intergenic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1092795436 12:12106463-12106485 CTGGCTCCCCAAATGGGAAAAGG - Intronic
1093350620 12:18095617-18095639 CAGGATCCCCAAATGGTGGAGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093553383 12:20442020-20442042 ATGGATCCAGAAATGCAAAAGGG - Intronic
1095202519 12:39400730-39400752 CTAGGTCCAGAAATAGAGAAAGG + Intronic
1095270639 12:40214651-40214673 CTGCATCCACACATGGCAAAAGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1100959757 12:99949392-99949414 CAGGATCAACATTTGGAGAATGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104378903 12:128290086-128290108 CTGGATCCAAAGGTGCAGAAAGG + Intronic
1104605197 12:130183029-130183051 CTAAATCCATAACTGGAGAAAGG + Intergenic
1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG + Exonic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG + Intergenic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1110788414 13:79560532-79560554 ATGGCTCCACCCATGGAGAATGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112837180 13:103530389-103530411 CTGGATCCAGAAGTGGTTAAAGG + Intergenic
1113970302 13:114183598-114183620 CTGCATCCTCATATGGTGAAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114202208 14:20532453-20532475 CTGTATCCTCACATGGGGAAGGG + Intergenic
1114888757 14:26889023-26889045 CTGGGTCCTCATATGGTGAAAGG + Intergenic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1124046675 15:26156818-26156840 CTGGAGCCACAAGTGGAAACTGG - Intergenic
1124362071 15:29044972-29044994 CTGTGTCCACACATGGTGAAAGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125215201 15:37264040-37264062 CTGCATCCTCACATGGTGAAAGG - Intergenic
1125401331 15:39306836-39306858 CTTGATTCACAAGTGGACAAAGG - Intergenic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1128719136 15:69933202-69933224 CAGCATCCACAATTTGAGAAGGG - Intergenic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129352241 15:74962858-74962880 CTGGCCCCACAGATGGGGAATGG + Intronic
1129743327 15:78000863-78000885 GTGGTCCCACAGATGGAGAAGGG - Intronic
1130080551 15:80729173-80729195 CAGGAACCAGAAATAGAGAAAGG - Intronic
1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG + Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134246027 16:12540865-12540887 CTGGGTCCAGAAGTGGAAAAGGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136069745 16:27780772-27780794 CAGGATCCACACATGGTGAAGGG - Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141268462 16:82518186-82518208 CTAGATCCACAAATGGCTAAAGG - Intergenic
1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG + Intergenic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1149179100 17:53912729-53912751 CTTGGTTCACAAATGGACAATGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1155438002 18:25833222-25833244 CTGTATCCTCACATGGGGAAAGG - Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164064751 19:21706357-21706379 CTGGCTCCACAAACTGAGGAGGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165154142 19:33777297-33777319 CGGGATCCAGAAATGGGCAAAGG + Intergenic
1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG + Intronic
1167639282 19:50671767-50671789 CTGGCTCTACATCTGGAGAATGG - Intronic
1167718803 19:51163152-51163174 ATTGATCAAGAAATGGAGAAAGG + Intergenic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
931409247 2:62013093-62013115 CTTGATTCACCTATGGAGAATGG + Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932975372 2:76593685-76593707 CAGGATTCACAAATGAAAAATGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
937749985 2:125464448-125464470 CTTGATCGACAAGTGTAGAATGG - Intergenic
939753957 2:146086041-146086063 CAGGAGCCAAAAATAGAGAAGGG - Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
941878024 2:170454605-170454627 CTGGATCCATCAAAGGAGAGGGG + Intronic
942331751 2:174832687-174832709 CTGTATCAATAAATGTAGAAGGG - Intronic
944761231 2:202816653-202816675 TGGGATTCAGAAATGGAGAAAGG - Intronic
945835216 2:214831627-214831649 CTGGATCCACAAGTGAACATCGG - Intergenic
947817776 2:233049367-233049389 CTGGATCCAGGTATGGAGTAAGG + Intergenic
948592088 2:239057017-239057039 CGGGACCCTAAAATGGAGAAAGG + Intronic
1169836025 20:9880087-9880109 CTGGAACCACACAGGGAGACAGG - Intergenic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173113234 20:40215867-40215889 CTGTATCAACCAATGGAGACTGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG + Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1183402505 22:37612942-37612964 CTGAATCCAGAAATGGATAGTGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
1184908806 22:47511711-47511733 CTGCATCCTCACATGGTGAAAGG - Intergenic
1185419438 22:50727318-50727340 CTGGATCCAGAAATGGCAAGGGG + Intergenic
949139089 3:610431-610453 CAGGAATCAGAAATGGAGAAAGG - Intergenic
952124794 3:30287798-30287820 CTGCATCCACACATGGTGGAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG + Intergenic
955148815 3:56346834-56346856 CTGCATCCTCCAATGGAGAAAGG + Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
957927509 3:86833363-86833385 CTGTATCCGCAAATTGGGAAGGG - Intergenic
958081775 3:88754939-88754961 CTGTATCAGCAAATGGTGAAAGG - Intergenic
958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG + Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961630861 3:128297353-128297375 CTCAATCCACAAATAAAGAAAGG - Intronic
961988913 3:131166787-131166809 CTGGATCCCTAGTTGGAGAAAGG + Intronic
962131889 3:132688351-132688373 CTGGTTCCACATTTGGATAAAGG + Intronic
962607618 3:137045570-137045592 CTGTATCCTCACATGGGGAAGGG + Intergenic
963347741 3:144116017-144116039 CTGCATCCACACATGGTAAAAGG - Intergenic
963492453 3:146018361-146018383 CTGCTTCCAGAACTGGAGAAGGG - Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964659783 3:159107302-159107324 CTGTGTCCACAAATGGCAAAAGG - Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
966294601 3:178404702-178404724 CTGGAACCACAAAAAGAGAAAGG - Intergenic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
967806175 3:193716355-193716377 CTGCATCCTCAAAAGGGGAAGGG + Intergenic
968309252 3:197669283-197669305 TGGGATCCCGAAATGGAGAAAGG - Intergenic
969884084 4:10199947-10199969 CTGGATCCAGAAAAGCAGGAAGG - Intergenic
970412736 4:15825285-15825307 CTGTTTCCACTCATGGAGAAGGG + Intronic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
972842374 4:42946654-42946676 CTGTATCCTCACATGGTGAAAGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
979772688 4:124548401-124548423 CTGCTTCCACAAATGGTGAAAGG - Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982376403 4:154695798-154695820 CTGGTTACAGAAATGGGGAATGG - Intronic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
986006175 5:3670979-3671001 CTGTATCCACATATGGGGAGGGG - Intergenic
988105202 5:26737162-26737184 CTGTATCTAGTAATGGAGAAGGG - Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
995316664 5:110782383-110782405 TTGCTTCCACACATGGAGAAAGG + Intergenic
995985313 5:118163892-118163914 ATTGATCCAGAAATGGAGTAGGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG + Intergenic
997695695 5:135858943-135858965 CAGGATCAACTACTGGAGAAGGG + Intronic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1002600512 5:180352022-180352044 GTGGCTCTACACATGGAGAATGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1010655275 6:78504411-78504433 AAGGCTCCACAAATGGATAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011570785 6:88732199-88732221 CCTGATCCAAAAATGGACAAAGG + Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015346386 6:132164326-132164348 CAGGATCAACAATTGGGGAATGG - Intergenic
1015395492 6:132729494-132729516 GTGGATCCACTAAGGCAGAAAGG - Intronic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018162101 6:161054896-161054918 CTGGGTCCACAAATGGATATGGG - Intronic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1021001405 7:15335792-15335814 CTGAAACCACAACTGAAGAAAGG - Intronic
1021543235 7:21783764-21783786 CTGGATCCACAAGAGGAGAGTGG + Intronic
1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG + Intergenic
1024846375 7:53648196-53648218 CTGCTTCCACCAATGGTGAAAGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1026365748 7:69646702-69646724 CTGGGTCTACAAAAGGAGAGAGG - Intronic
1026434517 7:70383929-70383951 CTGAAGCCAAAAATGGGGAATGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029034920 7:97509354-97509376 CTAGATCCAGCCATGGAGAAGGG - Intergenic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033285675 7:140038847-140038869 CTGAGTCCAGCAATGGAGAAGGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034949832 7:155289832-155289854 CTGCATCCTCACATGGTGAAGGG + Intergenic
1035619521 8:1027332-1027354 CTGGTACCACACCTGGAGAATGG - Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1036678367 8:10852910-10852932 CTGGTCTCACAAATGAAGAAGGG - Intergenic
1036991626 8:13604713-13604735 TGGGGTCAACAAATGGAGAATGG - Intergenic
1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG + Intergenic
1037619816 8:20553782-20553804 CTGGATCCTCAAACAGAAAAAGG - Intergenic
1040482604 8:47840390-47840412 CTGGATCCTGAAATAGAAAAAGG + Intronic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1041812645 8:61928454-61928476 CTGCTTCCACAAGTGGTGAAAGG - Intergenic
1043530382 8:81143454-81143476 CTGGATCTTCACATGGTGAAAGG - Intergenic
1045356144 8:101390794-101390816 CTGGTTCCACAAACTAAGAAGGG + Intergenic
1045364745 8:101465322-101465344 CCAGATTCAAAAATGGAGAAAGG + Intergenic
1045790644 8:105978941-105978963 CTGGATGGGCAAATGGGGAAGGG + Intergenic
1046805538 8:118475339-118475361 CTGCTTCCACTCATGGAGAATGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048335455 8:133498953-133498975 CTGGGTCCAAAAATTCAGAAGGG - Intronic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG + Intergenic
1052942423 9:34140317-34140339 TTGGATCCTCAAAGGGATAAAGG + Intergenic
1053861614 9:42392457-42392479 CTGGATCCACAAATCAAGTTAGG - Intergenic
1056257688 9:84816853-84816875 TTCGTTCAACAAATGGAGAAGGG - Intronic
1056547941 9:87628433-87628455 CCGGTTCGACAAATGCAGAAAGG + Intronic
1057458181 9:95233617-95233639 GTGGATGCAAAAATGGAAAATGG + Intronic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060493980 9:124104609-124104631 GTGGATCCACTGATGCAGAAAGG - Intergenic
1203618258 Un_KI270749v1:89889-89911 CAGGAATCAGAAATGGAGAAAGG + Intergenic
1187343729 X:18444224-18444246 ATGGTTCCATAAATGGAAAATGG - Intronic
1187563350 X:20423379-20423401 CTGCATCCTCACATGGTGAAAGG - Intergenic
1188134071 X:26472434-26472456 CTGCATCCTCCAATGGTGAAAGG - Intergenic
1188620708 X:32219789-32219811 CAGGATCCTGAAATGAAGAATGG - Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1196216475 X:113058145-113058167 CTGGGTCCAGAAATGGGAAAAGG - Intergenic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1198164478 X:134041048-134041070 CTGCATCCTCACATGCAGAAGGG - Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1202277738 Y:23142744-23142766 CTACATCCAGAAATGAAGAATGG + Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202287465 Y:23266023-23266045 CTACATCCAGAAATGAAGAATGG - Intronic
1202287630 Y:23268407-23268429 CTACATCCAGAAATGAAGAATGG - Intronic
1202287795 Y:23270792-23270814 CTACATCCAGAAATGAAGAATGG - Intronic
1202287959 Y:23273176-23273198 CTACATCCAGAAATGAAGAATGG - Intronic
1202288125 Y:23275560-23275582 CTACATCCAGAAATGAAGAATGG - Intronic
1202288289 Y:23277944-23277966 CTACATCCAGAAATGAAGAATGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic
1202439405 Y:24884080-24884102 CTACATCCAGAAATGAAGAATGG - Intronic
1202439569 Y:24886465-24886487 CTACATCCAGAAATGAAGAATGG - Intronic
1202439734 Y:24888850-24888872 CTACATCCAGAAATGAAGAATGG - Intronic
1202439899 Y:24891234-24891256 CTACATCCAGAAATGAAGAATGG - Intronic
1202440064 Y:24893619-24893641 CTACATCCAGAAATGAAGAATGG - Intronic