ID: 1124721278

View in Genome Browser
Species Human (GRCh38)
Location 15:32113023-32113045
Sequence GCCTTTCCATGCCTGGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124721274_1124721278 2 Left 1124721274 15:32112998-32113020 CCCCTGTTGAATGGATCAAACAT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 173
1124721275_1124721278 1 Left 1124721275 15:32112999-32113021 CCCTGTTGAATGGATCAAACATG 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 173
1124721276_1124721278 0 Left 1124721276 15:32113000-32113022 CCTGTTGAATGGATCAAACATGT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124721278 Original CRISPR GCCTTTCCATGCCTGGACTT TGG Intronic