ID: 1124721278

View in Genome Browser
Species Human (GRCh38)
Location 15:32113023-32113045
Sequence GCCTTTCCATGCCTGGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124721274_1124721278 2 Left 1124721274 15:32112998-32113020 CCCCTGTTGAATGGATCAAACAT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 173
1124721275_1124721278 1 Left 1124721275 15:32112999-32113021 CCCTGTTGAATGGATCAAACATG 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 173
1124721276_1124721278 0 Left 1124721276 15:32113000-32113022 CCTGTTGAATGGATCAAACATGT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124721278 Original CRISPR GCCTTTCCATGCCTGGACTT TGG Intronic
901758963 1:11458475-11458497 CCCTGTCCATACCTTGACTTTGG + Intergenic
903893071 1:26583058-26583080 TTCTTTCCAGACCTGGACTTGGG + Intergenic
904945335 1:34195045-34195067 TCCTTCCCATGTCTAGACTTAGG - Intronic
907106880 1:51891315-51891337 TCCATTCCATACCTGAACTTGGG + Intergenic
907667051 1:56442516-56442538 GCCAGTGCATGCCTGGAGTTTGG + Intergenic
909526236 1:76625972-76625994 GCCTTTACTTGCATTGACTTTGG - Intronic
911023563 1:93413000-93413022 GCCTTGACCTCCCTGGACTTAGG + Intergenic
913284052 1:117211088-117211110 GCCTTTCCAAGTCTTGACTTTGG + Intergenic
914978518 1:152390484-152390506 GCATTTCCATACCTGAAATTTGG + Intergenic
915516672 1:156417192-156417214 CCCTTTCCATGCCTGGAATTGGG + Intronic
919220255 1:194618993-194619015 AGATTTCCATGCCTGGATTTGGG - Intergenic
919791579 1:201294008-201294030 GCCATTCCCTGCCTGGAACTTGG - Exonic
922352248 1:224743963-224743985 CCCTTTCTCTTCCTGGACTTGGG + Intergenic
922600682 1:226850063-226850085 GCCTGTTCATTCCTGGACTTTGG - Intergenic
923684380 1:236143436-236143458 ACCTTTCCAGGCCGGGAGTTAGG - Intronic
924103315 1:240626115-240626137 GCCTTTCCTTGGCTGAAGTTCGG + Intergenic
1063467680 10:6258000-6258022 GAGTGTCCATGCCTGGGCTTAGG - Intergenic
1063856050 10:10255325-10255347 GCCTTTCACTTCCTGCACTTTGG - Intergenic
1064249563 10:13696481-13696503 GCCTGTCCATCCCAGCACTTTGG + Intronic
1064301840 10:14129904-14129926 GGCTTTCCATGGCTGGAGCTGGG + Intronic
1064322451 10:14318384-14318406 TCCTTTACATGCTTGGCCTTGGG - Intronic
1069324434 10:67215585-67215607 GCCTGTCCTTATCTGGACTTTGG - Intronic
1073486232 10:103820654-103820676 GCCTTTCCCTGCATGGGCCTGGG - Intronic
1074460229 10:113629929-113629951 GCCTTTCAGAGCCAGGACTTGGG - Intronic
1076228405 10:128799683-128799705 GCCTTTACACGCCTGTAGTTAGG - Intergenic
1083545743 11:63547747-63547769 GCCTTTCCCTGCCAGTATTTTGG + Intergenic
1087008104 11:93488686-93488708 GCCTTTTCATGCCTCTACTAGGG - Intronic
1087051523 11:93890525-93890547 GAGTTTCCATGCCTGGTCCTAGG - Intergenic
1089162488 11:116450185-116450207 ACCTTTCCAAACCTGAACTTAGG + Intergenic
1092151896 12:6254710-6254732 TCCTGCCCATTCCTGGACTTTGG - Intergenic
1093382479 12:18510049-18510071 GCCTTTACCTCCCTGGACTCAGG + Intronic
1100370508 12:93964943-93964965 GCCTATCCCTGCCTGGCTTTGGG - Intergenic
1101327387 12:103727992-103728014 GCCTCTCCATGCCTGTATTTTGG + Intronic
1104501485 12:129290282-129290304 GCCCTTCCATGCAGTGACTTAGG - Intronic
1105956044 13:25283780-25283802 TCCTTTCCCTGCCAGTACTTTGG - Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1106589391 13:31086507-31086529 ACCTTTCCCTTCTTGGACTTTGG + Intergenic
1107310694 13:39073989-39074011 CCATGTCCATTCCTGGACTTTGG - Intergenic
1110791397 13:79590473-79590495 ACAATTCCATGCCAGGACTTTGG + Intergenic
1111383685 13:87495159-87495181 TCTTCTCCCTGCCTGGACTTGGG + Intergenic
1113458783 13:110467429-110467451 GCCTTTCCATCCCAGGATCTAGG + Intronic
1115448235 14:33516835-33516857 GCCCTGCCCTGCCTGGCCTTTGG + Intronic
1117474150 14:56076862-56076884 GCCGTTGCATCCGTGGACTTTGG - Intergenic
1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG + Intronic
1125523937 15:40363819-40363841 GCAGTTCCCTGCCAGGACTTGGG + Exonic
1125736710 15:41932204-41932226 GCTTGTCCATGTCTGTACTTCGG - Intronic
1128644496 15:69365656-69365678 TGCTGTCCTTGCCTGGACTTGGG + Intronic
1130108382 15:80945699-80945721 GTTTTTCCATGTCTGGACTGTGG + Intronic
1130967874 15:88710513-88710535 CCCCTTCCATGCCTGGCCCTAGG - Intergenic
1131649498 15:94383420-94383442 GGCTTTCAAGGCCTGGTCTTGGG + Intronic
1133214842 16:4285757-4285779 GCCTTTGCAATCCTGGACTTGGG - Intergenic
1135190195 16:20348390-20348412 GCCTTTCCAGGCCTGGGATGAGG + Intronic
1135344643 16:21678590-21678612 GACTTACCCTGCCTGGAATTTGG - Exonic
1135953011 16:26932872-26932894 GACTATCCATGGCTGGACTAAGG + Intergenic
1135992213 16:27224927-27224949 GCCTTGCCTTTCCTGGAGTTCGG - Intergenic
1136458741 16:30397048-30397070 GTCTTTCCATGCCTGTAATATGG + Intronic
1137490297 16:48926834-48926856 GCCTTTCCATCCCTGGAGAAAGG + Intergenic
1140114795 16:72032530-72032552 CCTTTTCTATGCTTGGACTTAGG + Intergenic
1142483436 17:232199-232221 GCCTTTCCATGCTGAGACTACGG + Intronic
1142823432 17:2491553-2491575 GCCCTTCCATGCTAGGTCTTTGG + Intronic
1144786379 17:17834616-17834638 GGCTGCCCATGCCTGGCCTTTGG + Intronic
1146910516 17:36645589-36645611 GCCTTTCCATTCCTGGGTTAAGG + Intergenic
1147150545 17:38511264-38511286 GCCTTTCTGTGGCTGCACTTGGG + Exonic
1147377930 17:40033819-40033841 GCCTCTGCAAGACTGGACTTTGG - Intronic
1148136277 17:45293958-45293980 GCCTTCCCAGCCCTGGACTTTGG + Intronic
1148359245 17:46998332-46998354 CCCTTTCCCTGCCTAGACCTTGG + Intronic
1148652457 17:49259952-49259974 GGCTTTCCAGGCCGGGACTGCGG + Intergenic
1150419429 17:65018766-65018788 GCCTGTCCATGCCTGTGGTTGGG - Intronic
1151664920 17:75540346-75540368 GCTTTTCCATGCCTTGACCTGGG + Intronic
1151694961 17:75709997-75710019 GCCTTTTAATACCAGGACTTTGG + Intergenic
1154191276 18:12232617-12232639 TCCTTCCCACGCCTGGACTTTGG + Intergenic
1155705730 18:28809334-28809356 GTTTTTCCATTCCTTGACTTTGG - Intergenic
1158029563 18:52946717-52946739 TACTTTCCACCCCTGGACTTTGG - Intronic
1158444180 18:57504439-57504461 GCCTTGCCAAGCTTGGACTCAGG + Intergenic
1160061760 18:75535250-75535272 GCCTTTCTCTGCCTGCATTTCGG - Intergenic
1160413170 18:78688479-78688501 CCCTTTCCATCCCTGGCCTGAGG + Intergenic
1162120497 19:8463841-8463863 GCCATTCCCTGCAAGGACTTTGG + Intronic
1163226379 19:15964251-15964273 TCCTCTCCCTGCCTGGACTCTGG + Intergenic
1166293579 19:41878310-41878332 GCCTCTCCCTGCCTGGGCTGAGG - Intronic
1167472902 19:49685292-49685314 GCCTTTCCGTGCATGGGCTGTGG - Intronic
1168295727 19:55376673-55376695 GCCTGGCCATGCCTGGTCTAGGG - Intergenic
925063529 2:911644-911666 GCCTTTGCCTGCCCGGGCTTGGG - Intergenic
926049089 2:9731483-9731505 GCCTGTCTGTGCCTGGACTCTGG + Intergenic
926701696 2:15808219-15808241 GCCTTCCCATGGCAGGACTAGGG + Intergenic
929140921 2:38666028-38666050 CCCTTTCCCTGCCTGGATTTAGG - Exonic
929858318 2:45653938-45653960 TCTTTTCCATGCATGGCCTTTGG + Intronic
931064962 2:58575223-58575245 GCTTTTGCATGCCTCGACTAGGG - Intergenic
935296379 2:101653245-101653267 GCCTTCCCATGCCTGGACCCTGG - Intergenic
940173515 2:150853728-150853750 GCCTTCCCTTGTCTGGACCTAGG + Intergenic
940389101 2:153110517-153110539 GCCTTTCCTTTACTAGACTTAGG - Intergenic
944175216 2:196821221-196821243 CCCTACCCATGCCTGGATTTTGG + Intergenic
945084297 2:206115745-206115767 GTATGTCCATACCTGGACTTGGG - Intronic
945357648 2:208857980-208858002 GCCTTTGCATCCCTGGGCTCAGG - Intergenic
948820327 2:240540021-240540043 GCCTTGCCATGCATGGCTTTAGG - Intronic
1171409522 20:24936676-24936698 GCCCTTCCCTGCCTGGCCTTGGG - Intergenic
1172160297 20:32863321-32863343 GCCCTTGCAAGCCAGGACTTCGG - Intronic
1172326675 20:34041202-34041224 CCCTTTCCTTCCCTGTACTTTGG - Intronic
1175741643 20:61423850-61423872 GCCTTTCCTCGCCTGGCCTCTGG + Intronic
1175846300 20:62060733-62060755 GCCTTTGGAGGCCTGGACCTGGG - Intronic
1181292519 22:21807503-21807525 GATTTTCCATGACTAGACTTAGG + Intronic
1181601515 22:23954987-23955009 CCCTTCCCATGCCTGGACTGCGG + Intergenic
1182268878 22:29140387-29140409 GCCTTCCCTTTCCTGGAATTGGG - Intronic
1182733383 22:32513125-32513147 GCCTTTGCCTGCCTGGTCTAAGG + Exonic
1184103090 22:42351864-42351886 GCCTCTCCAGGCCTGGACTAAGG - Intergenic
1184407241 22:44307110-44307132 GCCCTTCCAGGCCTGTTCTTGGG - Intronic
950689851 3:14646959-14646981 GCCTTGCGATGCCTTGATTTAGG + Intergenic
952744313 3:36763420-36763442 TCCTTTCCATGTCTGGCCCTGGG - Intergenic
953025469 3:39142470-39142492 ACCTTGCCCTGCCTGGGCTTTGG - Exonic
953051376 3:39347416-39347438 GAATTTCCATGCCTGGTCCTAGG - Intergenic
953840519 3:46386481-46386503 GCCTGACCAGGCCTGGACTATGG + Intergenic
954394344 3:50285377-50285399 GCCTGTAAATGCCAGGACTTTGG + Intronic
954691730 3:52399298-52399320 GTCTTTCCATGCCCTGGCTTAGG - Intronic
956410096 3:68970308-68970330 GCCTTTCCCTGCCTCACCTTAGG + Intergenic
956768823 3:72507268-72507290 TCTGTTCCAGGCCTGGACTTTGG - Intergenic
961037125 3:123650176-123650198 GCCTTTCCCTTCCTGGGCCTTGG + Intronic
961246140 3:125455446-125455468 GCCTTCCCATGCTTGGATTTAGG - Intronic
961346203 3:126265017-126265039 GGCTGTCCCTTCCTGGACTTAGG + Intergenic
964023082 3:152038718-152038740 CCTTATTCATGCCTGGACTTTGG + Intergenic
964731578 3:159872389-159872411 CCCTTTCCATGCCTGCCCTTTGG + Intronic
968291347 3:197542117-197542139 GCTTGTCCCTGCCTGGACTGAGG + Intronic
968954558 4:3711622-3711644 GCCTGGCCCTGCCTGGACTCTGG - Intergenic
969057361 4:4410121-4410143 CCCTTTCCCTGCGTGGCCTTGGG - Intronic
969995369 4:11306867-11306889 TCCTTTCCATGCTGGGACTCAGG - Intergenic
970534352 4:17014017-17014039 GACATTCAATGCCTTGACTTCGG + Intergenic
970905409 4:21210441-21210463 TCCTTTCTATGCCTGGATCTAGG - Intronic
970984837 4:22144986-22145008 GCCTTTCTATACATGGGCTTAGG - Intergenic
971242061 4:24898177-24898199 TCCTATCCTTGCCTGGGCTTTGG - Intronic
972965897 4:44509300-44509322 GGCATTCCAGGCTTGGACTTTGG - Intergenic
974615029 4:64269570-64269592 CCCTTGCCATGCATGGCCTTAGG + Intergenic
975697350 4:77026446-77026468 GCCTCTCCAGGACTGAACTTCGG + Intronic
976478745 4:85514312-85514334 GCCTTTGCATGCCTTCACTATGG + Intronic
977302454 4:95282934-95282956 TCTTTTCCATGGCTGGTCTTGGG + Intronic
977491970 4:97725802-97725824 ATCTTTCAATGCCTGGACTCAGG - Intronic
978127874 4:105156331-105156353 GCATTTCTATGCCTGAACATAGG - Intronic
982219556 4:153112877-153112899 CCCTGTCCATGCCTTGATTTTGG - Intergenic
983691918 4:170481323-170481345 CCCTTTCCTTGCATGGCCTTAGG + Intergenic
986477278 5:8147959-8147981 GCCTTGCCACACCTTGACTTGGG + Intergenic
986509454 5:8488668-8488690 GCCTTTTCTTGTCTGGATTTAGG - Intergenic
990765650 5:59178944-59178966 GCCTGTCCATTCCTCAACTTAGG + Intronic
991914167 5:71589448-71589470 GTCTTCCCATTCCTGGACTGAGG + Intronic
995454358 5:112336028-112336050 GCCTTTCCTTGCCTGGTGTAGGG - Intronic
995585161 5:113641283-113641305 GCCTTTGCAGTCCAGGACTTGGG + Intergenic
997589224 5:135062760-135062782 GCCTCTCTTTGCCTGGAATTTGG + Intronic
1001318698 5:170662889-170662911 GCATTTCAAGGACTGGACTTTGG + Intronic
1002575339 5:180170931-180170953 GCCTTTCCCTGCCTGGAGAGTGG + Intronic
1004535036 6:16492103-16492125 GCTAAGCCATGCCTGGACTTCGG + Intronic
1007761798 6:44137658-44137680 GCCTTTACATGCCTGGAGGGTGG + Intronic
1009460489 6:63907051-63907073 GCAGATCCATGCCTGGACTCTGG + Intronic
1013089151 6:106883651-106883673 TACTTTCCATGGCTGGCCTTAGG + Intergenic
1014564695 6:122933340-122933362 TCCTTTCCATGGCTGGATTTAGG + Intergenic
1015858113 6:137647352-137647374 GTCTTTGCAGTCCTGGACTTGGG + Intergenic
1016309145 6:142714566-142714588 GCCTTGCCATGCCTGCAGCTGGG + Intergenic
1016699093 6:147033780-147033802 GCCTTTGCCTGCCTGGTCTAAGG - Intergenic
1017043178 6:150324163-150324185 GCCTTTCCCTCCCAGGAGTTCGG + Intergenic
1018323074 6:162634129-162634151 ACCTCTCCATACCTGGGCTTTGG + Intronic
1018483024 6:164211142-164211164 TCGTTTCTATGCCTGAACTTAGG - Intergenic
1019921813 7:4168029-4168051 TATTTTCCATTCCTGGACTTTGG - Intronic
1022824532 7:33995529-33995551 GCCTTTCCATTTCTGAGCTTAGG - Intronic
1024672355 7:51607774-51607796 GCCTTCCCATCCCAGAACTTGGG - Intergenic
1028833521 7:95349870-95349892 GCCTTTCCATGGCTTCACTCAGG - Intergenic
1030832367 7:114241380-114241402 TCCTTTCCTTACCTGGATTTTGG - Intronic
1031111849 7:117620255-117620277 GCCTTGCCATGTGTGGCCTTGGG + Intronic
1032426605 7:131827723-131827745 GCCTTTCTTTGCCTGGGCTCTGG + Intergenic
1033859541 7:145607571-145607593 GCCTCTTAATGCCTGGACTTTGG + Intergenic
1034964798 7:155384351-155384373 CCCTGCCCACGCCTGGACTTTGG - Intronic
1035119157 7:156550297-156550319 GCCTTTTCCTCCCTGGATTTGGG - Intergenic
1035175531 7:157047277-157047299 GGCTTGCCATGGCTGGCCTTGGG + Intergenic
1038347469 8:26745447-26745469 GCCTTTACTTGCCTGGGCTGAGG + Intergenic
1038401582 8:27288230-27288252 GCCACTCCTTGCATGGACTTGGG - Intronic
1039122785 8:34167503-34167525 GCCTGTCTTTACCTGGACTTTGG - Intergenic
1039252654 8:35683739-35683761 CCCTATCCATTCCTGGCCTTTGG - Intronic
1039619992 8:38988028-38988050 CCCTTTCCATGGCTGTTCTTCGG + Exonic
1040996276 8:53406010-53406032 GTGTTTCCATGCATGTACTTAGG + Intergenic
1041804848 8:61838821-61838843 GCCTTTCCTTGTCTGGATCTAGG - Intergenic
1045006982 8:97924785-97924807 TTCTTTCCTTGCCTGGACTCAGG - Intronic
1045778891 8:105840189-105840211 GCCTTTCCATGCCTAAAATCTGG - Intergenic
1046883767 8:119340126-119340148 GCCTCTCCATGGTTGGTCTTTGG - Intergenic
1047031411 8:120885843-120885865 GCTTTTCAATGCGTGGATTTAGG - Intergenic
1047759007 8:127940208-127940230 GCCTGTCCAGGCCTGGATTATGG - Intergenic
1049131883 8:140852772-140852794 GCCTTTTCTTTCCTGGAATTAGG - Intronic
1051132574 9:13878864-13878886 TCCTTTGCAAGCCTGGAATTTGG + Intergenic
1051735416 9:20193003-20193025 GCTTTTCCATCCCTAGTCTTGGG + Intergenic
1051972846 9:22911906-22911928 GCCTTTCCTTGTCTGGATCTAGG - Intergenic
1052558403 9:30050522-30050544 ACCTTTCAACTCCTGGACTTTGG - Intergenic
1053337845 9:37292928-37292950 GTCTTTCCAAGCCAGTACTTTGG - Intronic
1056578578 9:87873753-87873775 GCCCATACATGCCTGGACTCAGG - Intergenic
1058564765 9:106270820-106270842 TCCTTTCCATCCCTGTACATTGG + Intergenic
1059760278 9:117330878-117330900 TCCTTTCCATGGCTGGAATGAGG + Intronic
1190510492 X:51169399-51169421 GCCTTCCCTTGTCTGGACCTAGG + Intergenic
1196088090 X:111708109-111708131 GCCTTTTCAGGCCTAGACTTTGG + Exonic
1196257687 X:113541146-113541168 GCCTTCCCTTGTCTGGATTTAGG + Intergenic
1200082483 X:153585047-153585069 GCCTGCCCATGCCTTGATTTTGG - Intergenic