ID: 1124722375

View in Genome Browser
Species Human (GRCh38)
Location 15:32121206-32121228
Sequence CATCAGCTCCACCGACCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124722375_1124722378 -7 Left 1124722375 15:32121206-32121228 CCACATGGTCGGTGGAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1124722378 15:32121222-32121244 GCTGATGCTGTCAGTCGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 128
1124722375_1124722380 6 Left 1124722375 15:32121206-32121228 CCACATGGTCGGTGGAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1124722380 15:32121235-32121257 GTCGGCCGGGTGGTATTTTCTGG 0: 1
1: 0
2: 1
3: 2
4: 23
1124722375_1124722382 8 Left 1124722375 15:32121206-32121228 CCACATGGTCGGTGGAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1124722382 15:32121237-32121259 CGGCCGGGTGGTATTTTCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 49
1124722375_1124722381 7 Left 1124722375 15:32121206-32121228 CCACATGGTCGGTGGAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1124722381 15:32121236-32121258 TCGGCCGGGTGGTATTTTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 38
1124722375_1124722377 -8 Left 1124722375 15:32121206-32121228 CCACATGGTCGGTGGAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1124722377 15:32121221-32121243 AGCTGATGCTGTCAGTCGGCCGG 0: 1
1: 0
2: 3
3: 14
4: 155
1124722375_1124722379 -4 Left 1124722375 15:32121206-32121228 CCACATGGTCGGTGGAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1124722379 15:32121225-32121247 GATGCTGTCAGTCGGCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124722375 Original CRISPR CATCAGCTCCACCGACCATG TGG (reversed) Intronic
901438601 1:9264163-9264185 GATCAGCTCCTCGGACCAGGCGG - Exonic
901643703 1:10705643-10705665 CATCAGCCCCTCAGCCCATGTGG - Intronic
905125143 1:35710928-35710950 CATCAGGTCCACTGGCCACGAGG - Intergenic
906805936 1:48778759-48778781 CATCAGCTGCACTGACAATGAGG + Intronic
912135894 1:106659823-106659845 CATCAGCACTCCAGACCATGAGG - Intergenic
915585145 1:156840365-156840387 CCTCAGCTCCACTGACCAGGTGG - Exonic
918186968 1:182136247-182136269 CATCAGCTCCACTGCCAATATGG + Intergenic
1064995903 10:21296554-21296576 CAACATCTCCCCAGACCATGTGG + Intergenic
1067827102 10:49584384-49584406 CTTCAGCTCCTCCCACCATGTGG + Intergenic
1068027568 10:51666661-51666683 CAACAGCTGCATCTACCATGTGG - Intronic
1074727339 10:116325038-116325060 CATCATCTTCACCGAGCATCAGG + Exonic
1077019248 11:410255-410277 GATCACCTCCACCGGCCCTGGGG + Intronic
1077168834 11:1157504-1157526 CGGCAGCTCCACTGCCCATGTGG + Intergenic
1077241767 11:1514299-1514321 CTTCAGCTCCACCATCCAAGGGG + Intergenic
1079022525 11:16921399-16921421 CATCAGCCCCACAGACCCTATGG + Intronic
1079323901 11:19475376-19475398 CAGCAGCTCCGCCTTCCATGTGG - Intronic
1083160923 11:60853620-60853642 CATCCGCTACATCGACCACGCGG - Exonic
1088231479 11:107677614-107677636 CATCAGCTTCACACACCGTGGGG + Intergenic
1088231605 11:107678852-107678874 CATCAGCTTCACGCACCCTGGGG + Intergenic
1101906835 12:108833255-108833277 CATTAGCTCCAGCTTCCATGGGG - Intronic
1102467989 12:113141692-113141714 CATGTGCTCCACAGGCCATGTGG + Intergenic
1104613834 12:130252581-130252603 CATCAGCTCCACCCCACCTGGGG + Intergenic
1107083910 13:36405388-36405410 CACCACCACCACAGACCATGAGG + Intergenic
1110302196 13:73941908-73941930 CATCAGCTCCACTCACAAGGAGG + Intronic
1115880447 14:37911166-37911188 CATCAGTCCCACCAACCATATGG - Intronic
1119044086 14:71302149-71302171 CATCACCTTCAGAGACCATGTGG + Intergenic
1120909015 14:89648589-89648611 CATGATCTCCTCAGACCATGGGG - Intergenic
1124722375 15:32121206-32121228 CATCAGCTCCACCGACCATGTGG - Intronic
1131236110 15:90698491-90698513 CAGCAAATCCACCAACCATGGGG - Intergenic
1132057268 15:98661864-98661886 CACCAGGGCCACCCACCATGAGG - Intronic
1133244577 16:4439574-4439596 CATCAGATCAACTAACCATGTGG - Intronic
1135822048 16:25692975-25692997 CGTCAGCACCCCCGACTATGGGG + Exonic
1135937798 16:26795844-26795866 GACCAGCACCACAGACCATGGGG + Intergenic
1136283817 16:29229960-29229982 CCTCAGATCCACAGGCCATGGGG - Intergenic
1137061515 16:35794965-35794987 CAGCAGCTCCACAGCCCAGGTGG + Intergenic
1137504065 16:49035757-49035779 AACCAGCTCCAGGGACCATGAGG - Intergenic
1137597717 16:49735824-49735846 CAGCAGCTCCAAACACCATGCGG + Intronic
1137642692 16:50046621-50046643 CTGCAGCTCCAGCTACCATGCGG - Intergenic
1138225367 16:55290186-55290208 AATCAGCTCAAGAGACCATGTGG + Intergenic
1139253731 16:65521129-65521151 CATCAGCTCCAACACCTATGAGG + Intergenic
1141621323 16:85238100-85238122 CAACAGCACCACAGGCCATGTGG - Intergenic
1142088853 16:88199470-88199492 CCTCAGATCCACAGGCCATGGGG - Intergenic
1142222942 16:88864328-88864350 GATCAGCTCCACAGACCGCGGGG - Exonic
1142911720 17:3098893-3098915 CACCAGCTGAACCGACCAAGTGG + Intergenic
1151367576 17:73627456-73627478 CCTCAGCTCCCCCACCCATGTGG + Intronic
1157274605 18:46301941-46301963 CAGCTGCTCCACCCACCATGAGG + Intergenic
1162032554 19:7923732-7923754 CATCAGCTTCACCTGCCCTGTGG + Intergenic
1163726276 19:18924841-18924863 GGTCAGCTCCACTGTCCATGTGG - Intronic
1168241047 19:55089039-55089061 CACCAGCTTCTCCGACCACGGGG + Intergenic
925005014 2:436282-436304 ACTCAGCTCCACTGACCATCTGG + Intergenic
925844658 2:8024525-8024547 CATTAGCTGCACCCAGCATGGGG - Intergenic
926782214 2:16483671-16483693 CATCAGCTCCACAGACAGAGAGG + Intergenic
929988006 2:46756587-46756609 AAACAGCACCACCCACCATGTGG - Intronic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
935344230 2:102090203-102090225 CACCACCACCACCTACCATGGGG + Intronic
946419682 2:219557826-219557848 CCTCAGCTTCACCGTCCAGGTGG - Exonic
948482147 2:238256949-238256971 CAGCAGCACCATCGTCCATGTGG - Exonic
1174392174 20:50224424-50224446 CATCAGCTAGACAGAGCATGGGG + Intergenic
1177487742 21:21780957-21780979 CATCAGCTGAAACGATCATGTGG + Intergenic
1178277458 21:31252018-31252040 CAGCAGCTCCACCGGGGATGCGG - Exonic
1180105755 21:45617119-45617141 CATCAGCTCAGCGGACCAGGGGG + Intergenic
1181311228 22:21945997-21946019 CCTCAGCTCCACTGGCCATTGGG + Exonic
1181408761 22:22703467-22703489 CATGAGCTCCAGAGAGCATGTGG - Intergenic
1182436293 22:30332691-30332713 CAGAAGCTCCATTGACCATGAGG - Exonic
1184522699 22:45004866-45004888 CATCAGCTCCACGGACTCTTGGG + Intronic
949570249 3:5285531-5285553 CATCAGCCCCAACTGCCATGTGG - Intergenic
956775424 3:72561418-72561440 CAGCAGCCCCAGTGACCATGGGG + Intergenic
958517750 3:95141105-95141127 GATGAGGTCCACCGACAATGGGG - Intergenic
959986886 3:112583625-112583647 CATCAGCTTCACTGACAATCTGG - Exonic
960157129 3:114307436-114307458 CATCAGCTCCCCAAACCGTGGGG - Intronic
965702100 3:171468467-171468489 CATTTGCTCCACAGAGCATGAGG + Intergenic
968936913 4:3615988-3616010 CCTGAGGTCCACCCACCATGGGG - Intergenic
969576658 4:8040042-8040064 CATCTCCTCCACGGACCGTGAGG - Intronic
981268134 4:142811787-142811809 CATCAGCTCCCCACTCCATGAGG + Intronic
986101207 5:4613406-4613428 CATCTTCTCCACCCATCATGAGG + Intergenic
988519879 5:31936142-31936164 CCTCAGCTCCACAGAGCATGGGG + Intronic
988732057 5:33982187-33982209 CTTCAGCTCCCCAGACAATGAGG - Intronic
990076784 5:51855601-51855623 CATCAGCTACACAGAGCATTTGG - Intergenic
990777949 5:59324378-59324400 CCTCAGCCCCAGCCACCATGAGG + Intronic
997383731 5:133456254-133456276 CTTCATCTCCACCCACCAGGAGG - Intronic
1002602001 5:180359124-180359146 CCTCACATCCACGGACCATGTGG + Intergenic
1002678246 5:180936757-180936779 CAGCAGCTCCACCAATCAAGTGG - Intronic
1023578822 7:41659436-41659458 CCTCAGCTCCACCTCCCCTGGGG - Intergenic
1029272766 7:99386692-99386714 CATCTGCCCCAACAACCATGAGG + Exonic
1034268434 7:149792096-149792118 CATCAGCTCCCCAGAGCAAGTGG - Intergenic
1035642014 8:1190992-1191014 CCTTAGCTCCCCTGACCATGAGG - Intergenic
1036541220 8:9713762-9713784 CACCAGATACACCAACCATGAGG - Intronic
1036684459 8:10900023-10900045 CATCAGTTCCACAGTCCATCTGG + Intronic
1038529762 8:28308732-28308754 CATTATCTTAACCGACCATGTGG + Intergenic
1040422387 8:47252328-47252350 CAGCAGCAGCACAGACCATGGGG + Intergenic
1048769387 8:137879677-137879699 CATCAGCTCTACCATCCGTGTGG - Intergenic
1049496454 8:142936523-142936545 CCACAGCTGCACCGACCGTGAGG + Intergenic
1057547049 9:96026521-96026543 CATCTGCTCCACACCCCATGCGG + Intergenic
1059247777 9:112863081-112863103 CATCTTCTCCACAGACCACGTGG - Intronic
1060100756 9:120839193-120839215 CATCTGCTCCAGCTACCATGTGG - Intronic
1061225508 9:129278794-129278816 CCTCAGCCCCACCCACCAGGTGG - Intergenic
1061288773 9:129639223-129639245 CATCAGCTCCAAGGTCCAGGAGG + Exonic
1186392141 X:9171593-9171615 CTTCAGCTCCCCTGACCATTAGG + Intergenic
1187715590 X:22099068-22099090 CATCAGCCCCTCCGAGAATGTGG + Exonic
1189856581 X:45229969-45229991 CACCAGCTCCATGGAGCATGCGG + Intergenic