ID: 1124722740

View in Genome Browser
Species Human (GRCh38)
Location 15:32124822-32124844
Sequence CCTTATAAGAAGAGACACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 3, 1: 19, 2: 49, 3: 114, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124722740 Original CRISPR CCTTATAAGAAGAGACACAA GGG Intronic
900849563 1:5131402-5131424 CCTTATAAGAAGAGACTCAGAGG + Intergenic
900893072 1:5463604-5463626 CCTTGTAAGAAGAGCCAGGAGGG + Intergenic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901311741 1:8274868-8274890 ACTTATCAGAAGAGAGAAAATGG - Intergenic
904195917 1:28785398-28785420 GCTTATAAGAAGAGGCACAGCGG + Intergenic
904213909 1:28904595-28904617 CCTTATAAGAAGAGACACCAAGG + Intronic
904273987 1:29368503-29368525 CCTTATAAGAAGAGACTCCAGGG - Intergenic
905364172 1:37439784-37439806 CCTTATAAGAATAAACACCCTGG - Intergenic
905486857 1:38305210-38305232 GCTCAAAAGAAGACACACAATGG + Intergenic
905502523 1:38450955-38450977 CCTTATATGAAAAGACACAGAGG - Intergenic
906957444 1:50386882-50386904 CCTTATAAAAAGAGACACAGAGG - Intergenic
907492434 1:54816699-54816721 CCTTTTAAGAAGAGATACACAGG - Intronic
907567778 1:55452332-55452354 GCTTATAAGAAGAGAGACACCGG - Intergenic
908878142 1:68700935-68700957 CCTTATAAGAAGAGAAAGTTTGG - Intergenic
908984687 1:70003182-70003204 CTTTACAAGAAGAGAAACCAGGG - Intronic
909214797 1:72873198-72873220 ACATATAAGAAAAGACACATTGG - Intergenic
909408557 1:75321486-75321508 CCTTGTAAGAAGAGACAATAGGG - Intronic
910399819 1:86827304-86827326 CCTTATAAAAAGAGGCCCAAGGG + Intergenic
910821849 1:91359189-91359211 CATTAGGAGAAGAGACACTATGG - Intronic
913092408 1:115486511-115486533 CCTTAGAAGAAGAGACACTAGGG - Intergenic
913304920 1:117418407-117418429 ACTTCTGAGAAGAGACCCAAGGG + Intronic
914413813 1:147458650-147458672 GCTGTTAGGAAGAGACACAAAGG + Intergenic
916291224 1:163168367-163168389 CCCTGAAAGAAGAGACACAAGGG + Exonic
916546908 1:165814260-165814282 TCTCAGAAGAAGAGACAGAAAGG + Intronic
916655323 1:166870279-166870301 CCTTATAAGAAGAGGCAATTAGG + Intronic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
916881474 1:169023382-169023404 CCTTATAAGAAGAGAAAATGTGG - Intergenic
917353593 1:174103513-174103535 CCATTCAGGAAGAGACACAATGG + Intergenic
917368578 1:174262010-174262032 CCTTAAAAGAAAACACAAAAAGG - Intronic
917468272 1:175303929-175303951 CCTTATAAGAAGAGAGATCAGGG - Intergenic
917742343 1:177972857-177972879 CCTTATAAAAAGACACAAGAGGG + Intronic
918147526 1:181770735-181770757 CCTTCTAAGATGTGACTCAATGG + Intronic
918200987 1:182266678-182266700 CCGTATAAGAAGAGACATGAGGG + Intergenic
918484549 1:185015515-185015537 CCTTATAAAAAGAGATAAGAGGG + Intergenic
918923656 1:190750280-190750302 CTTTATAAGAAGAGACGCTAGGG + Intergenic
919185405 1:194140963-194140985 TCTTATAAGAAGACATACAAAGG + Intergenic
919760215 1:201093272-201093294 CCTTATAAGAAGAGGAACTCTGG + Intronic
920007880 1:202846535-202846557 CCTTATAAGAGGAGGCAATAAGG + Intergenic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
921510851 1:216027221-216027243 CCTTATAAGAAGAGAAAATTTGG + Intronic
921954126 1:220964501-220964523 CCTTATAAAAAGAAAAACCAGGG - Intergenic
922348569 1:224717335-224717357 CCTCATAAGGAAAGACACTAAGG - Intronic
923001329 1:230008645-230008667 CTTTAAAAGAAGAGAAACAGGGG - Intergenic
923443863 1:234049301-234049323 CCTTTAAAGAAGAGATACCAGGG + Intronic
923463058 1:234223970-234223992 TCTTATAAGAAGAGACATCAGGG - Intronic
923492645 1:234498058-234498080 CCTTATAAGAAGAGAAAATTAGG + Intergenic
923738351 1:236633311-236633333 CCTTATAAGAAAAGACATCAGGG - Intergenic
924325973 1:242894135-242894157 CCTTATAAGGAGAGGCAGCAAGG + Intergenic
924606656 1:245541213-245541235 CATTTAAAGAAAAGACACAAAGG + Intronic
1064583788 10:16819307-16819329 CCTTAGAAGAAGAGACACCAAGG - Intergenic
1065747117 10:28852584-28852606 AATTATTACAAGAGACACAAAGG - Intronic
1065772076 10:29087034-29087056 CCTTGTAAGAAGAGACAATTTGG - Intergenic
1065893926 10:30144737-30144759 CCTTTTTAGAAGAGACACCAGGG + Intergenic
1066117089 10:32250116-32250138 CCTTATAAGAAGAGACACAGAGG + Intergenic
1066224340 10:33367706-33367728 GGTTATAAGAAGAGGCATAAAGG - Intergenic
1067128414 10:43540085-43540107 CCTTATAGGGAGAGACATCAGGG - Intergenic
1067356135 10:45529096-45529118 TATTATAAAAAGAGACACACAGG + Intronic
1067706944 10:48613157-48613179 CCTTAAAAGAAGAGTCACTGAGG - Intronic
1068450190 10:57176417-57176439 CATTATAAGAACATACAGAATGG - Intergenic
1069016473 10:63434756-63434778 GCTTTTAAGAAGCTACACAAAGG + Intronic
1069366155 10:67695999-67696021 CTTTATAGGAAGAAACAGAAAGG - Exonic
1069577020 10:69538048-69538070 CCTTATAAGAAGAGACTCCAGGG - Intergenic
1069681871 10:70291346-70291368 CCTTATAAAAGGAGACACCAGGG - Intergenic
1069847263 10:71380832-71380854 ACTTATAATAAGTGCCACAAAGG - Intergenic
1073362323 10:102909735-102909757 CCTTACAAGAAGAGACACCTAGG + Intergenic
1073922745 10:108478420-108478442 CCTTATAAGAACAGACCATAAGG - Intergenic
1074066224 10:110016670-110016692 CCTTACAAAATGAGACAAAAAGG - Intronic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1076191786 10:128488308-128488330 CCTTAAAAGAAGAGACACCAGGG - Intergenic
1076493008 10:130876470-130876492 CCTCATAAGAAGAGACAGCCAGG - Intergenic
1077062172 11:622289-622311 ACTTATAACAACAGACAAAAAGG + Intronic
1077258417 11:1600942-1600964 CTTCATAAGAAGAGACACCAGGG - Intergenic
1077475127 11:2784005-2784027 CCATATAAGAAAAGACAAATTGG - Intronic
1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG + Intergenic
1077964901 11:7119244-7119266 CCTCATTAGAAGATACACAAGGG + Intergenic
1078160677 11:8837282-8837304 CCTTTGAAGAAGAAACAAAATGG - Intronic
1078407403 11:11082406-11082428 CCTTATCAGAAGATACACAACGG + Intergenic
1079162884 11:18011339-18011361 CCTTAAAAGAAGAGACACCACGG + Intronic
1079288096 11:19158410-19158432 TCATATAAAAAGATACACAAAGG - Intronic
1079615582 11:22488626-22488648 CCTCATAAGAAGAGACATGAGGG + Intergenic
1080222925 11:29927319-29927341 CTTTATAGGAATAGACACAAGGG + Intergenic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1080979355 11:37381489-37381511 TCTTATAAAAAGAGACATAAAGG + Intergenic
1081010818 11:37810901-37810923 CCTTATAAAAAGAGACACCAGGG - Intergenic
1081196638 11:40168919-40168941 CCTTATAAGAGGAAACATGAAGG - Intronic
1081584941 11:44377718-44377740 CCTTATAAGAAGAGACACCAGGG + Intergenic
1084803107 11:71559048-71559070 CTTCATAAGAAGAGACACCAGGG + Intronic
1085409972 11:76285047-76285069 ACTTATAAAAAGAGACTCCAGGG + Intergenic
1085473917 11:76776886-76776908 TCTTAGAAGAAGAGAAAGAAAGG - Intergenic
1085674418 11:78502391-78502413 CCATATAAGAAGAGATACCAGGG - Intronic
1085833304 11:79926185-79926207 TCCTATAGGAACAGACACAAGGG - Intergenic
1086215727 11:84378205-84378227 CCCTAAAAGAAGAGACATCAGGG + Intronic
1086225469 11:84502951-84502973 CCTAATTAGAATAGACAGAAAGG + Intronic
1086284901 11:85236463-85236485 CCTTATAAGAAGATACACCAGGG - Intronic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1088230951 11:107672700-107672722 CCTTATAAGAAGAGTCAAAGAGG - Intergenic
1088698376 11:112389805-112389827 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1089407196 11:118207865-118207887 CCTGCTTAGAAGAGACACAGAGG - Intronic
1089900663 11:121980374-121980396 CTTTAGATGCAGAGACACAAAGG + Intergenic
1090527331 11:127551520-127551542 TCTTAGAAGAAGAAAAACAATGG - Intergenic
1091576401 12:1740451-1740473 CCTTGTAAGAAGAGACACCAGGG - Intronic
1092907096 12:13111226-13111248 CCTTCTCAGGAGACACACAATGG - Intronic
1093440025 12:19184000-19184022 CCTTATAAGACCAGGCACAGTGG - Intronic
1093475504 12:19549878-19549900 CCTTATAAGAAAAGAAAAACAGG - Intronic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1094111182 12:26864465-26864487 CCTTCTAAGAAGAGCCACTTTGG - Intergenic
1095283035 12:40379081-40379103 CCTTATAAGAAGAGAAAGTCTGG - Intergenic
1095695900 12:45143826-45143848 ACTTATAAGAAGAGACTCCAGGG - Intergenic
1095989923 12:48027554-48027576 CCTCATTAGCAGAGACAGAAAGG + Intergenic
1096309307 12:50505667-50505689 CCTTTCAAAAAGAGACACATGGG + Intronic
1097074841 12:56385216-56385238 CTTTATAAGAAGAGAAATACTGG + Intergenic
1098325956 12:69301509-69301531 CCTTATAAGAAGACAGGCACGGG - Intergenic
1099563010 12:84202895-84202917 CCTTATAAGAAGAGGCACCTTGG - Intergenic
1100388810 12:94129221-94129243 CCTTCTATGGAAAGACACAAAGG - Intergenic
1100408707 12:94293918-94293940 CCTTATAAGAAGAGACACCAGGG - Intronic
1100434062 12:94555484-94555506 CCTTATAAGAAGAGAGGGCATGG - Intergenic
1100442741 12:94631430-94631452 CCTTATAAGAAGAGAAAATCTGG + Intronic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1101214472 12:102566838-102566860 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1101579044 12:106025285-106025307 TCTTATATGAAGAGACACCAGGG + Intergenic
1102159836 12:110759731-110759753 TCTTATAAGAAGAGAGATTAGGG + Intergenic
1102749322 12:115278448-115278470 CCTTATAAGAAGAGGCAACTAGG - Intergenic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1102854462 12:116280951-116280973 CGTTGTAGGAAGAGACACAAGGG + Intergenic
1103037445 12:117667790-117667812 GCTTTTAGGTAGAGACACAAGGG + Intronic
1103882721 12:124178730-124178752 CCTCACAAGAAGAGGCACCAGGG + Intronic
1104004588 12:124883040-124883062 CCTTATAAGAAGAGGGACATCGG + Intergenic
1104705292 12:130940830-130940852 CCTTACAAGAAGAGACATGAGGG - Intergenic
1106436579 13:29728810-29728832 TCCTAGAACAAGAGACACAAAGG + Intergenic
1106625781 13:31419459-31419481 CCTTATAAGAAGAGAGAATTTGG + Intergenic
1107651135 13:42546385-42546407 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1107790586 13:43998334-43998356 CCTTATTTGAAGAGATAAAAAGG - Intergenic
1108203362 13:48063447-48063469 CCTTATAAGAAGAGAAAATCTGG + Intronic
1108392333 13:49958575-49958597 GCTTATTGGAAGTGACACAAAGG + Intergenic
1108956494 13:56165322-56165344 CTTTATAAGAAGAGATACCAAGG + Intergenic
1108982103 13:56527803-56527825 GCTTCTAAGAAGAAACACACAGG - Intergenic
1109283661 13:60386668-60386690 CCTTATTAAAAAATACACAAAGG + Intergenic
1109350057 13:61168854-61168876 CCAGATAAGAAGAGTAACAAGGG - Intergenic
1109845224 13:67980385-67980407 CCTTATAATATGAGACTCATTGG + Intergenic
1110067984 13:71133128-71133150 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1111151989 13:84264783-84264805 CTTTATAAGAAGAGACATCTGGG + Intergenic
1111308948 13:86456117-86456139 CCCTTTAAGGAGAGACAGAAGGG + Intergenic
1111533539 13:89572343-89572365 CCTTATTATTAGAGACACAGTGG - Intergenic
1111658362 13:91179216-91179238 TCTTATAAGAAGAGACCTAGAGG - Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1113141539 13:107157368-107157390 CCTAATCAGGAAAGACACAAGGG - Intergenic
1114232225 14:20793474-20793496 CCTGATAAAAAGAGACATGAGGG - Intergenic
1114233837 14:20806985-20807007 CCATATAAAAAGAGACAATATGG + Intergenic
1115129448 14:30037019-30037041 ACTTAAAAGAAGAAACTCAAGGG - Intronic
1115141878 14:30181314-30181336 ACTTATAAGAAGAGACATGATGG + Intronic
1116103445 14:40470013-40470035 CCTGAAAAGAAGAGACAAACTGG - Intergenic
1116289265 14:43011305-43011327 CCTTACAAGAAGAGACAGCAGGG - Intergenic
1116394857 14:44435533-44435555 CCTTATAAAAAAAGGCCCAAGGG - Intergenic
1116402253 14:44522234-44522256 CCTTATAAGAAGAAAAATATTGG + Intergenic
1116971293 14:51068817-51068839 GCTTATCAGAAGAGACATCATGG - Intronic
1117227207 14:53674374-53674396 CCTTACAAGAAGAGAGACCATGG + Intergenic
1118112359 14:62735836-62735858 CTTTATAAAAAGAGACAGATAGG + Intronic
1118264631 14:64283012-64283034 CCTTGCAAGAAGAGGCACAAAGG + Exonic
1119533590 14:75381404-75381426 CCTTATAACAAGAAAAAAAACGG + Intergenic
1119684799 14:76623058-76623080 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
1119777358 14:77257396-77257418 CCTTGTAAGAATAGAAAGAAGGG - Exonic
1119960983 14:78856547-78856569 ACGTATAAGAAGAGACAACAAGG - Intronic
1120715633 14:87838081-87838103 CCTTATAAGAAGAGAAAATTAGG + Intronic
1121280013 14:92691360-92691382 CCTTATAAGAAGAGACACCAGGG - Intergenic
1121911159 14:97793693-97793715 CCTTATAACAAATGACACACAGG + Intergenic
1122665257 14:103325401-103325423 CCTTATAAGAAGAGACACAGAGG + Intergenic
1123672545 15:22674025-22674047 CCTTATTAGAAGAGAAAGACAGG - Intergenic
1123993621 15:25703055-25703077 CCTTATAAAAAGAGGCACTGGGG + Intronic
1124141234 15:27078930-27078952 TCTTATAAGAGGAGTTACAATGG - Intronic
1124324595 15:28747314-28747336 CCTTATTAGAAGAGAAAGACAGG - Intergenic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1126021264 15:44403765-44403787 CGTTATAAGGAAAGCCACAAAGG + Intronic
1126930224 15:53639713-53639735 CCGCATGAAAAGAGACACAAAGG - Intronic
1127394293 15:58531257-58531279 CCTTAAAAGAAGATACACAAAGG - Intronic
1128816215 15:70610477-70610499 CTTTACAGGAAGAGAGACAAAGG + Intergenic
1129619062 15:77127093-77127115 CCTTCTAAGAACAGACACTGGGG + Intronic
1129970079 15:79770387-79770409 GTTTATAAGAAGACACATAATGG - Intergenic
1130439681 15:83940481-83940503 CTTTGTAAAAAGAGACACCAGGG - Intronic
1130796599 15:87216149-87216171 CCTTATAAAAAGAGCATCAATGG - Intergenic
1131751371 15:95511361-95511383 CCTTATAAGAAAAGACCAGAGGG + Intergenic
1131762825 15:95642738-95642760 TCTTGTAAGAAGAGGCACTAGGG - Intergenic
1132345840 15:101108265-101108287 CCTTATCAGAAGAGACACCAGGG + Intergenic
1134304555 16:13020515-13020537 TCCAATAAGAAGAGACACCATGG - Intronic
1135103020 16:19623383-19623405 CCTTATAGGAAGAGACAGCAAGG - Intronic
1135289821 16:21225702-21225724 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1135489409 16:22895731-22895753 CCATATAACAAAAGACACAGGGG - Intronic
1135519052 16:23159468-23159490 CCTTATAAGAAGAGAGATTGGGG - Intergenic
1136014431 16:27386303-27386325 CCTTATAAGAAGAGACACCAGGG - Intergenic
1136117992 16:28107725-28107747 CATGGTAAGAGGAGACACAAGGG + Intronic
1137539780 16:49354333-49354355 CCTTATAAAAAGAGACAAAGAGG + Intergenic
1139389061 16:66594182-66594204 CCTCATAAGGAAAGACACCAGGG + Intergenic
1139961053 16:70717508-70717530 CCTTACAGGAAGAAAAACAAAGG - Intronic
1140330064 16:74047714-74047736 CATTTTATGAAGACACACAAAGG + Intergenic
1141065601 16:80911284-80911306 CCTTATAAGAAGAGACAGCCGGG + Intergenic
1142647929 17:1327456-1327478 CCTTTTAAGAAGAGATATAGGGG + Intergenic
1145081661 17:19899279-19899301 CTTTATAAGAAGGGAAAAAATGG + Intergenic
1146829312 17:36054473-36054495 CCATATAAGAATACACAAAATGG + Intergenic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1149063311 17:52450246-52450268 CCTTATAAGAGGAGACGAAAGGG - Intergenic
1149524305 17:57342098-57342120 CCTAATGAGAGGAGAGACAAAGG - Intronic
1149977136 17:61277700-61277722 TCTTCAAAGAAGATACACAATGG + Intronic
1150428049 17:65093000-65093022 ACTTGTGAAAAGAGACACAACGG - Intergenic
1150453424 17:65288186-65288208 CCTTATAAGAAGAGACACATGGG + Intergenic
1150492863 17:65586494-65586516 CCCTATAAGAGGAGACACAAAGG - Intronic
1152256278 17:79241837-79241859 CCTTACAAGAACAGACACCAGGG - Intronic
1152287863 17:79422863-79422885 CCTTACAGGAAGAGACAGCAGGG + Intronic
1152302435 17:79503124-79503146 CCTTATAGCAGGAGACACCAGGG - Intronic
1153398900 18:4659785-4659807 TCTAAGAAGAAGAGACAGAAGGG + Intergenic
1153415460 18:4841128-4841150 CATTATAAAAAGAGACAAGAAGG - Intergenic
1154072351 18:11164017-11164039 ACTGATAAGCACAGACACAAAGG + Intergenic
1155752588 18:29445905-29445927 CCTTATAAGAAAAGAGAGACTGG - Intergenic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1157145090 18:45154328-45154350 CCTTATAAGAAAAGAAAATATGG - Intergenic
1157400884 18:47385904-47385926 TAGTATAAGAAGAGACACATAGG - Intergenic
1157528932 18:48406056-48406078 CCTGGGAAGAAGAGACTCAAGGG - Intronic
1159223067 18:65490909-65490931 CCTTATAAGAAGAGACACTGAGG - Intergenic
1159260847 18:66010212-66010234 CCTTACTAAAAGAGACAAAAGGG - Intergenic
1159278961 18:66259256-66259278 CCTTATCAGAAGAGAGGGAAGGG + Intergenic
1159299062 18:66538864-66538886 CCTTATAAGAAGACAGACACTGG - Intronic
1160416096 18:78712086-78712108 CCTTATGAGAACAGACAGGAGGG + Intergenic
1160595447 18:79970546-79970568 CTTTCTGAGAAGAGACGCAAGGG + Exonic
1162706866 19:12561597-12561619 CCTTATAAGAAGAGACACCAGGG + Intronic
1163496654 19:17649839-17649861 CCTTAGAAGAAGAGATACATGGG + Intronic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1167188751 19:47967609-47967631 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1168474597 19:56666767-56666789 CCTTATAAGAGGAGACACCAGGG + Intronic
925067589 2:940587-940609 CCCTATAGGAAGAGACCCCAGGG - Intergenic
925491577 2:4400944-4400966 CCTTATAAGGAGAGAGAGATTGG + Intergenic
925769131 2:7265363-7265385 CCTTGTTTGAAGAGAAACAAAGG - Intergenic
925957977 2:8986772-8986794 CCTTATAAAAAGAGACACAGAGG + Intronic
926459314 2:13109389-13109411 CCATATAAGAAAGGACAGAATGG + Intergenic
927245888 2:20956919-20956941 CCTTATAAGAAGAGCCAGTTAGG + Intergenic
927260357 2:21082008-21082030 CCCTGTAAGAAGAGACATCAGGG + Intergenic
927369258 2:22335771-22335793 CCTTTTAAGAAGAGACACAAAGG + Intergenic
928932741 2:36641030-36641052 AACTATAAGAAGAGACAAAAAGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929373028 2:41249934-41249956 CCTTATAAGAAGAAAAAATATGG + Intergenic
930149474 2:48044034-48044056 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
931300827 2:60976428-60976450 CTTCAAAAGAAGAGACACAAAGG - Intronic
933492767 2:83008712-83008734 CTTTATAAGAAGAGAGAGAGAGG + Intergenic
934014310 2:87862730-87862752 CCTTATAAGAAGATAAACCACGG + Intergenic
934697775 2:96412481-96412503 CCTTGTAAGAAGAGACACCACGG + Intergenic
935227322 2:101064222-101064244 CCTTATAAGAAGAGACACCGGGG + Intronic
935241173 2:101179400-101179422 CCTTATAAGAAAAGAGACAGAGG - Intronic
935427873 2:102940165-102940187 CCTTTAAAGAAGAAACACCAGGG + Intergenic
936510953 2:113146234-113146256 CACTATAAGAAAAGACAAAAAGG - Intergenic
936844234 2:116811606-116811628 TCCTATGAGAAGAGACAAAATGG + Intergenic
937002438 2:118479758-118479780 CTTTATCAGGAGAGACAAAAGGG - Intergenic
937419410 2:121741633-121741655 CATTATAAGAAGAGATACCGGGG - Intronic
937591461 2:123618102-123618124 ATCTATAAGAAGAGACAAAAAGG + Intergenic
937747342 2:125430348-125430370 CCTTAAAAGTGGAGACATAAAGG - Intergenic
937900810 2:127017627-127017649 CCTTCAAAGAAGGGACACAGTGG + Intergenic
938260337 2:129891456-129891478 CCTTATGAGAAGAGTCACAGAGG - Intergenic
938389169 2:130891695-130891717 CCTGGTAAGAAGAGACGCCAGGG - Intronic
938978637 2:136504544-136504566 CCTTATAAGAAGAGAAAATCTGG - Intergenic
939812069 2:146845983-146846005 CCTTATAAAAAGTGTCACAGAGG + Intergenic
940320349 2:152370309-152370331 CCTTATAAAAAGAGACCCCGGGG - Intronic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
940927116 2:159376861-159376883 CCTTGGAAGAATAGACAGAAAGG + Intronic
940976642 2:159953288-159953310 CTGAATAAGAAGAGACACAAGGG - Intronic
941238468 2:163006587-163006609 CCTTATAAGAAGAGGAAATATGG - Intergenic
941889276 2:170561210-170561232 CCTTAAAAGAAGAGTTAGAATGG + Intronic
941982022 2:171468971-171468993 CCTAATAAGAAGAAACAGAAAGG + Exonic
942803145 2:179899080-179899102 CCTTATAAGAAGTGACACCAGGG - Intergenic
943374945 2:187065079-187065101 CCTTATAAGACTAGACACAGTGG - Intergenic
943759464 2:191592575-191592597 CCTTATAAGAGGAGGCTCACAGG - Intergenic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
946114561 2:217450073-217450095 CATAATAAGAAGAGATACATGGG + Intronic
946888004 2:224243863-224243885 CTTTATAAGTAGACACACAGAGG + Intergenic
947027234 2:225750099-225750121 TCTTATAAGAAGAGATACAAGGG + Intergenic
947813246 2:233018433-233018455 CCTTATAAGAAGAGAAAATTAGG - Intergenic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
948561922 2:238860032-238860054 CCTGATGGGAAGACACACAAGGG + Intronic
1170102713 20:12720079-12720101 CCTTATAAGAAGTGACACCAGGG + Intergenic
1170235611 20:14101682-14101704 CCTTAAAAGCAGAGATACAGGGG - Intronic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170522558 20:17202639-17202661 CATTCTGAGAAGAAACACAAAGG + Intergenic
1170984166 20:21242888-21242910 CCATACAAGAAGAGCCACAGGGG - Intronic
1172242647 20:33423504-33423526 CCTGATAAGCAGTGACACATGGG + Intronic
1172911948 20:38416099-38416121 CCTTATAAGAAGAGACACCAGGG + Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173498769 20:43537426-43537448 CCTTACAAGAAGAGACACTTTGG - Intronic
1173990125 20:47295743-47295765 CCATCAAAGAAGAGACCCAAAGG + Intronic
1174633391 20:51978035-51978057 CCTTATAAGAAGAGAAGACATGG + Intergenic
1174703590 20:52634166-52634188 CCTTATAAGAAGAGAGACCCAGG + Intergenic
1175569333 20:60007095-60007117 CCTAATAAGAAGAGATACCAGGG - Intronic
1175687502 20:61042207-61042229 CCTTATAAGAAGAGAAAATTAGG + Intergenic
1175774594 20:61645015-61645037 CCTTGTAAGAAGAGACTCCCGGG - Intronic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176993199 21:15522553-15522575 CCTTAAAAAAAGAGGCCCAAGGG - Intergenic
1177105648 21:16952249-16952271 TCTTAAAAGAAGACACACAAAGG + Intergenic
1177696004 21:24571932-24571954 CCTTATAAGAAGAGAAAAATAGG + Intergenic
1177857739 21:26418797-26418819 TCTTATAAGAAGAAACATAAGGG + Intergenic
1178156923 21:29865115-29865137 CTTTGTAAAAATAGACACAAGGG - Intronic
1178596142 21:33954621-33954643 CCTTATAAGAAGAGACACCAGGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1179009784 21:37547258-37547280 CCTTAGAACAAGAGACACGCCGG + Intergenic
1179028981 21:37703583-37703605 CATTATAAGAAGAGACCCTGGGG + Intronic
1179058822 21:37960590-37960612 CCTTATAAAAAGAGACTCCAGGG - Intronic
1181504906 22:23346970-23346992 CCTGATAAGAAGAAAGACTACGG - Intergenic
1181709894 22:24677217-24677239 CCTGATAAGAAGAAAGACTACGG - Intergenic
1182240900 22:28915311-28915333 CCTTATAAGAAGAGAAAATTTGG - Intronic
1182246210 22:28959779-28959801 CCTTATAAAAAGGGACACCAGGG + Intronic
1182817530 22:33179051-33179073 CTTTATAAGAAGAAACATCAAGG - Intronic
1183011433 22:34950039-34950061 CCTTATAAGAAGAGACACCTGGG + Intergenic
1184509412 22:44924522-44924544 TCTTATAAGAAGAGACACGAGGG + Intronic
1184792887 22:46711610-46711632 TCTCAAAAGAGGAGACACAAAGG - Intronic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949152516 3:787277-787299 CTTTCTAAGAAGAACCACAATGG + Intergenic
949373359 3:3359889-3359911 CCTTAGAAGAAGAGAAAAACTGG - Intergenic
949452603 3:4203463-4203485 ACTTACATGAAGACACACAAAGG - Intronic
949873117 3:8606291-8606313 CCTTATAAGAAGAGATGCAAGGG - Intergenic
950327904 3:12129930-12129952 CCTCATAAGAAGAGAGACCACGG + Intronic
950601087 3:14036230-14036252 CCTAATAAAAAGATACAGAATGG - Intronic
951035943 3:17931929-17931951 CCTTATAATATGACACACAGAGG - Intronic
952928139 3:38336857-38336879 CCTTATAAGAAGAGGAAAATTGG - Intergenic
953295780 3:41714725-41714747 CATCATAAGAAGAGACACTGTGG + Intronic
955424018 3:58768783-58768805 CATTGTAAGAAGAGAGACTACGG - Intronic
955825221 3:62938973-62938995 CCTTATAAGAAGAGACACAGAGG - Intergenic
956228455 3:66986363-66986385 CCTCATAAGAAGAGATATCAAGG - Intergenic
956568734 3:70670247-70670269 CCTTATAAGAAGAGGAAATATGG - Intergenic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
958421471 3:93936473-93936495 CCTTATAAGAAGGGACTCAGGGG + Intronic
958470551 3:94512502-94512524 CCTTATAAGAAGAGACACCGAGG + Intergenic
959608112 3:108264132-108264154 CCTTATAAGAAGAGACACAGAGG + Intergenic
959733988 3:109636656-109636678 CCTTATAAAAAGAGAAACTGTGG - Intergenic
959784189 3:110273839-110273861 CCTTATAAGAAGAGACACCAGGG - Intergenic
960124804 3:113986753-113986775 CCTTATAAGAAGCGATACCGTGG + Intronic
961347049 3:126270098-126270120 CCTTTTAAGAAGAGAAACTGAGG - Intergenic
961492032 3:127263090-127263112 CCCCATAAGAAGAGACACCAGGG - Intergenic
961518627 3:127454399-127454421 CCTTCTAAGAAGAGAGAATAAGG - Intergenic
961524797 3:127489851-127489873 TCTCATAAGAAGAGGCACCATGG + Intergenic
961925840 3:130479166-130479188 CCTTATAATAAAGGACACAAGGG + Intronic
962627295 3:137238647-137238669 CCTTATAACAAGAGAGTCCAGGG + Intergenic
963269678 3:143273392-143273414 CCTTATAAGAAGAGATGCTAGGG + Intronic
963728957 3:148952356-148952378 CCTTATAAGAAGAGGCAATTAGG - Intergenic
963891803 3:150644419-150644441 TCATATAAAAAGAGACACATAGG + Intergenic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
963943530 3:151119476-151119498 CTTTATAAGAGGAGACACCACGG - Intronic
964623585 3:158738587-158738609 CCTTATAAGAAGAGACACAGAGG - Intronic
964642642 3:158926539-158926561 CATTCTAAGAAGAGGCACAATGG + Intergenic
964643721 3:158936152-158936174 CCTTCTAAGAAGAGGCACAATGG + Intergenic
965509568 3:169553817-169553839 CCTTATAAGAAAAGACAATTAGG - Intronic
965671825 3:171155637-171155659 CCACAAGAGAAGAGACACAAAGG + Intronic
965840083 3:172894761-172894783 CCTTATGAAAAGAGGCCCAAGGG + Intronic
965970863 3:174554986-174555008 CCTTGTAAAAAGAAACTCAAAGG - Intronic
966004574 3:174993969-174993991 CCCTATAAGAAGAGAGAAATTGG - Intronic
966441397 3:179949024-179949046 TCTAAATAGAAGAGACACAACGG - Intronic
966535861 3:181032985-181033007 CCTTATAAGAAGAGACTACAGGG - Intergenic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
968745802 4:2359504-2359526 CCTTATAAGAAGAGGAAATATGG + Intronic
968947430 4:3672728-3672750 CCTTATGAGAAGAGACTCCAGGG - Intergenic
970025575 4:11620780-11620802 CCTTATAAGAAGAGAAAATTTGG + Intergenic
970030311 4:11666761-11666783 GGTTATAAGAAGAGATACAGTGG - Intergenic
970313772 4:14809657-14809679 CATTATAACAACAGACATAATGG + Intergenic
971637433 4:29079509-29079531 TATAAGAAGAAGAGACACAAGGG - Intergenic
971972913 4:33643424-33643446 GCTCATAAAAAGAGACAGAAAGG + Intergenic
971982386 4:33769314-33769336 TCTTCAAAGAAGAGACACCAGGG + Intergenic
972336238 4:38109281-38109303 CCTGATAAGATCAGAGACAATGG - Intronic
972584625 4:40426143-40426165 CCTGAGGAGAAGAGACAAAAAGG + Exonic
972745705 4:41930529-41930551 CATTATAAGAAGAGAAAGAGAGG + Intergenic
974445996 4:61982443-61982465 CCTTATGAAATGAGACAAAAGGG - Intronic
974805290 4:66871934-66871956 CCTTGTAAGAGGAGATACTAGGG - Intergenic
975312499 4:72918280-72918302 CCTTACAAAAAGAGGCCCAAGGG - Intergenic
975749929 4:77512574-77512596 CCTTATAAGAAGAGAAAATTTGG - Intronic
976387023 4:84471979-84472001 CCTTATAAGAAAAGATACTAGGG + Intergenic
978082691 4:104613922-104613944 AACTATAAGAAGAGACAAAAAGG - Intergenic
978265223 4:106815777-106815799 CCTCATAAGAAGAGACACCAGGG + Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
978305468 4:107323390-107323412 CCTCACAAGATGAGACCCAATGG - Intergenic
978937568 4:114396644-114396666 CCTTGTAAAAAGAGACACAAAGG + Intergenic
979098095 4:116576128-116576150 GCTTTTAAAAAGAGACACCAAGG + Intergenic
979963067 4:127044590-127044612 ACTTATAAGAAGAAAAACTAAGG - Intergenic
980098136 4:128514279-128514301 CCTTATAAGAAGAGACACCCGGG + Intergenic
981016719 4:139981240-139981262 CCTTAAAAGAAAAGAAACACCGG - Intronic
981052061 4:140318996-140319018 CCTTGTTAGAAGAAACAAAAAGG - Intronic
981289590 4:143058692-143058714 ACTTCTAAGAGAAGACACAATGG + Intergenic
981530512 4:145749151-145749173 AATTATAAGAAGAGACAAAGAGG - Intronic
982712966 4:158776729-158776751 CATTAAAAGCAGAGACACAATGG - Intronic
983746194 4:171203309-171203331 CATCACAATAAGAGACACAAAGG - Intergenic
984426273 4:179590928-179590950 CCTTATAAGAAGAGAAAAGGAGG - Intergenic
984606798 4:181795362-181795384 CTTTATAAGAAGAGACACAGGGG - Intergenic
984672979 4:182513514-182513536 CCTTACAAAATGAAACACAAAGG - Intronic
985228273 4:187785846-187785868 CATGATAAGACGAGGCACAATGG + Intergenic
985275633 4:188234796-188234818 AGTTATAAGAAGATACAGAATGG - Intergenic
986201891 5:5586693-5586715 CCTTATAAAAAGAAAAAAAAAGG - Intergenic
986427053 5:7643869-7643891 CTTTAAAAGAAAACACACAATGG - Intronic
986981000 5:13447944-13447966 CCTGAAAAGAAGAGAAATAAAGG + Intergenic
987203565 5:15601973-15601995 CCTTATGAAAAGAGACACAGAGG + Intronic
987549109 5:19355588-19355610 AATTATAATAAGAGACAAAAAGG + Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
988221497 5:28352282-28352304 TCTTAAAAGAAGACATACAAAGG + Intergenic
988420159 5:30995866-30995888 TCTGAAAATAAGAGACACAACGG - Intergenic
989225707 5:39025712-39025734 CCTTATAAAAAGGGACCCCAGGG - Intronic
990206682 5:53437228-53437250 CCTATTAAGAAAAGAAACAAAGG + Intergenic
990716157 5:58639534-58639556 CCTTAAAAGAAGAGAGATCAGGG - Intronic
990998459 5:61757548-61757570 ACTAAGAAGAAGAGACAAAATGG - Intergenic
991173206 5:63653149-63653171 CCTTATAAGAAGGGAAGAAAGGG - Intergenic
991386588 5:66097355-66097377 CCATGTAAAAAGAGACCCAAAGG + Intergenic
991998200 5:72409332-72409354 CCTTATAAGAAGAGAGAAATAGG - Intergenic
992027605 5:72685984-72686006 TCTTATAAGAAGAGAAAGAGAGG + Intergenic
992671309 5:79063751-79063773 CCTTATCTGCAGAAACACAATGG - Exonic
993168706 5:84387876-84387898 CCTTATAAGAAGAGACACCAAGG + Intergenic
993582800 5:89683887-89683909 TCTCAAAAGAAGACACACAAAGG + Intergenic
996542019 5:124640369-124640391 CCTTATAAGAAAGCACACGAGGG + Intronic
996728599 5:126695282-126695304 CATTATAACAAGTGACACAATGG - Intergenic
997833874 5:137176841-137176863 TATTATAAGAAGAGAAACCAGGG - Intronic
997901006 5:137764255-137764277 CCTTATAAGAAGAGCCCAGAGGG + Intergenic
998023704 5:138794584-138794606 CCTTATAAGAAGGAACCAAATGG - Intronic
998783484 5:145684084-145684106 CCTTGTGAAAAGAGACAAAAGGG + Intronic
999063935 5:148664660-148664682 GCTTATAAGAAAAGACAAAAAGG - Intronic
1000122363 5:158209378-158209400 CCTGATAAGAAGAGACAAAGTGG - Intergenic
1000643327 5:163731651-163731673 CCTCATAACAAAAGACACAAGGG - Intergenic
1001853136 5:174986876-174986898 CCTGATAAGAAGAGACACCAGGG + Intergenic
1001888586 5:175319072-175319094 CTTTATAAGAAGAGAGAGAGCGG + Intergenic
1001895510 5:175376567-175376589 GCTTATAGGCAGAGCCACAATGG - Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1003768869 6:9274471-9274493 CCTCATAAGAAGAGACACCAGGG - Intergenic
1003814971 6:9829208-9829230 CCTTTTAAGAACTAACACAAAGG + Intronic
1004361737 6:14977302-14977324 CCTTAGAAGAAAAGACACAGAGG - Intergenic
1004959832 6:20774657-20774679 GCTTATGAGAAGAGAAACCAAGG - Intronic
1007144803 6:39617701-39617723 CCTTTTAATAAGTGACATAAAGG + Intronic
1008279884 6:49584361-49584383 CCTTATAAGAAGAGACAATTAGG - Intergenic
1009025921 6:58000329-58000351 CCTTGTAAGAAGAAACACCAGGG + Intergenic
1009201476 6:60751796-60751818 CCTTGTAAGAAGAAACACCAGGG + Intergenic
1009643330 6:66364839-66364861 ATTTATGAGAAGAGACAAAAAGG - Intergenic
1009688037 6:66988545-66988567 CATTATAAAAAGAGACAAAGAGG - Intergenic
1009769801 6:68130897-68130919 TCTCATAAGAAGACATACAAAGG - Intergenic
1010057068 6:71578911-71578933 CCATATAGACAGAGACACAAAGG - Intergenic
1011191087 6:84729121-84729143 CCATATCAGAAGAGACAAAGAGG - Intronic
1011487706 6:87860174-87860196 CCTTATAATAAGAGACACCAGGG - Intergenic
1011961044 6:93090626-93090648 CCTTATAATAAGTGGTACAAAGG + Intergenic
1012020325 6:93909743-93909765 CATTTTAAGAAGAGACAAGATGG - Intergenic
1012112675 6:95257047-95257069 CCTTGTAAGAAAAGGCAGAATGG + Intergenic
1012271810 6:97222289-97222311 CCTTATAGGGAGAGAAAAAAAGG + Intronic
1012482337 6:99680921-99680943 CCTTATAAGAAGAGGAAAATTGG + Intergenic
1013277972 6:108604903-108604925 CCCTATAAGAAGAGAGAAAAAGG + Intronic
1013487077 6:110607358-110607380 CCTTATAAGAAGACACCCCAGGG - Intergenic
1014503538 6:122224610-122224632 CTTTAAAAGAAGAGAAAGAAAGG - Intergenic
1015214750 6:130736821-130736843 CATTATAAAAAGGAACACAAAGG - Intergenic
1015796958 6:137022767-137022789 CCTTATAAGAAGACAGCCATGGG + Intronic
1016194725 6:141320269-141320291 CCTCAAAAGAAAATACACAATGG + Intergenic
1016796523 6:148123814-148123836 CCTTATAAGAAAAGAAACCTTGG - Intergenic
1017645221 6:156533970-156533992 CCTTATAAGAAGAGAAACCAGGG - Intergenic
1018161109 6:161043275-161043297 CCAGCAAAGAAGAGACACAAGGG - Intronic
1018244357 6:161807733-161807755 CCTTATAGGACGAGAGACAAGGG - Intronic
1018540817 6:164877336-164877358 GTTTATAAAAAGAGACCCAAGGG - Intergenic
1018637692 6:165878745-165878767 CCTTATAAGAAGGGTCACATCGG + Intronic
1019922193 7:4170063-4170085 CCTTCTTAGAAGAAATACAATGG - Intronic
1019954604 7:4403478-4403500 CCTTATAAGAAGAGACATCAGGG - Intergenic
1020023002 7:4880228-4880250 CCTCAGAGGAAGAGAAACAAAGG - Intronic
1022499899 7:30876275-30876297 CTGTATAAGAAAAGACACAAAGG - Intronic
1023134633 7:37038875-37038897 CCTTATCAGAAGAGACACCAGGG - Intronic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1024542709 7:50492025-50492047 CCTTATAAGAAGAGAAAATTTGG + Intronic
1024670494 7:51589548-51589570 CCTTATAAGAAGAGACATGAGGG + Intergenic
1025707617 7:63881939-63881961 CCTTATTAGAAGAGGCATTAAGG + Intergenic
1026082454 7:67234044-67234066 CTTTATAAGAAGAGACATCAGGG + Intronic
1027638430 7:80704267-80704289 GACTATAAGAAGAGACACCAGGG - Intergenic
1027694086 7:81387114-81387136 TCTTATAAGAAAAGATACCAGGG - Intergenic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1028031865 7:85925921-85925943 CCATGTAAGAAGAGAAATAATGG - Intergenic
1028569195 7:92267441-92267463 CCTTATATGAAGAACCACAATGG - Intronic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1030251816 7:107454543-107454565 CCTTATACTAAGAAACACAAAGG - Intronic
1030472702 7:109986732-109986754 TCTTATAAGAAAAGACATCAGGG + Intergenic
1030740481 7:113103370-113103392 CCTTATAAAAAGAGGAACAAGGG - Intergenic
1030775788 7:113532669-113532691 CCTTATAAGAAATGCCAAAAGGG + Intergenic
1030825908 7:114157640-114157662 ACTTGTAAGAAGAGGCACCAGGG + Intronic
1031191685 7:118561088-118561110 ACTTATAAGAAGAGATACCAGGG + Intergenic
1031438899 7:121768352-121768374 CATTAGAAGATGAGAGACAAAGG + Intergenic
1031505985 7:122583441-122583463 CCTTTTAAGAAGAAATTCAAGGG - Intronic
1031628465 7:124018031-124018053 CCTTATAAGGAGAGACACTGAGG + Intergenic
1031802233 7:126261863-126261885 CCATATAAGAAGCAACGCAATGG + Intergenic
1031958626 7:127968475-127968497 CCTTACAAAAAGAAACTCAATGG - Intronic
1032533516 7:132641411-132641433 CCTTGCAACAAGAGACACAAGGG - Intronic
1034198432 7:149265532-149265554 CCTTGTAAGAGGAGACACAAGGG - Intronic
1034280103 7:149847713-149847735 CCTTTAGAGAAGAGACAGAAGGG - Exonic
1034726376 7:153339994-153340016 CCTTATAAGAAGAGAAAACTTGG - Intergenic
1035624435 8:1060516-1060538 CCTTTTAAGAAGAGACGCTCAGG - Intergenic
1035708164 8:1692587-1692609 TCTTAGAAGAGGAGAAACAAGGG + Intronic
1035962100 8:4148670-4148692 CCTTACTAGAAGAGACACGAGGG - Intronic
1036415090 8:8539563-8539585 CCTTAAAATTAGAGTCACAAGGG + Intergenic
1036608687 8:10330993-10331015 CCTTATACGAAGAGACACCAGGG + Intronic
1036995179 8:13647036-13647058 CCTCATAACAAGAGATACAAAGG - Intergenic
1037069600 8:14627426-14627448 CGTTGGAAGAAGAAACACAATGG - Intronic
1037396576 8:18449955-18449977 CCTTTTAAGAAGAGACACCAGGG - Intergenic
1038288665 8:26228648-26228670 GCTGATAAGCAGAGGCACAACGG - Intergenic
1038340991 8:26684764-26684786 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1038656551 8:29457839-29457861 ACTTGTAACAAGAGACACCATGG + Intergenic
1040446281 8:47498132-47498154 TCTTATAAGAAAACACACATCGG - Intronic
1040554817 8:48469223-48469245 CTTTATAAGATTTGACACAAAGG - Intergenic
1041194636 8:55388594-55388616 CCTTATACAAAGAGACATGAGGG - Intronic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1041356018 8:57001155-57001177 CTTTATTAGAAGAGTAACAATGG - Intergenic
1041410236 8:57545716-57545738 TCTGCTAACAAGAGACACAATGG - Intergenic
1041548594 8:59075583-59075605 CCCTATAAGAAAAGACAGATTGG - Intronic
1041777069 8:61535037-61535059 CCTTATAAGAAGAGGAACTTTGG - Intronic
1041882708 8:62770549-62770571 CCTCATAAGAAGAGACATGAGGG - Intronic
1043055911 8:75438271-75438293 CTGTATAAGAAGAGACAAATAGG - Intronic
1043420073 8:80088785-80088807 CCTAGTAAGAAGAGACACTAGGG + Intronic
1044739849 8:95314974-95314996 TCTTATAAGAAGAGACATCGGGG - Intergenic
1044846338 8:96385535-96385557 CCTTATAAGAAGAGGAAAATAGG + Intergenic
1045766894 8:105683065-105683087 CCTTATAAAAAGGGGCCCAAGGG - Intronic
1046092177 8:109516413-109516435 CCTTCTAAAAGGAGACACCAGGG - Intronic
1046519238 8:115303049-115303071 CCTTATAATAAGAGACACCAGGG + Intergenic
1046944753 8:119964096-119964118 CCTTATCAAAACAGACAAAAGGG - Intronic
1046996609 8:120531050-120531072 CCTGATAAGTTGAGAAACAATGG - Intronic
1047287318 8:123498726-123498748 CGTTATAAAAAAAGACAGAAGGG - Exonic
1048625554 8:136181261-136181283 CTTTATAAGAAGAGACAATTAGG - Intergenic
1048636995 8:136307634-136307656 CCTTATAAAAAGACACACTTAGG - Intergenic
1048935360 8:139350741-139350763 TCATATAAGAAGAGAAACTAAGG + Intergenic
1049053211 8:140215333-140215355 GATTATTAGAAGAGACACAGAGG + Intronic
1049161085 8:141098294-141098316 TCTCAGAAGAAGACACACAATGG - Intergenic
1049635543 8:143686650-143686672 TTTTCTAAAAAGAGACACAAAGG - Intronic
1049733295 8:144190158-144190180 CCTTATAAGAAGAGATGCAGAGG - Intronic
1050269314 9:3925303-3925325 CATTCTAACAAGAGACACACCGG - Intronic
1050369512 9:4906405-4906427 CCTTATAAGAAGAGAAAATGTGG + Intergenic
1050535129 9:6624355-6624377 CCTTATAAGAAGAGCAAAATTGG + Intronic
1050627688 9:7522738-7522760 CATTGAAAGAAGAGACCCAATGG - Intergenic
1050639275 9:7649224-7649246 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1050701140 9:8340308-8340330 TCTTATGAGGAGACACACAAGGG + Intronic
1050784059 9:9376733-9376755 CTTTATAATAAGAGACCCGAGGG - Intronic
1050851487 9:10292378-10292400 CCTTATAAAAATATATACAATGG + Intronic
1053192161 9:36081447-36081469 ACATATAAGAACAGACACATAGG - Intronic
1054833518 9:69652013-69652035 TTTTAGAAGAAGAGACACCAGGG + Intronic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1055093659 9:72388306-72388328 CTTTATAAGAAGAGAAAGAGAGG - Intergenic
1055243516 9:74214386-74214408 AAATATAAGAAGAGACAAAAAGG - Intergenic
1055344496 9:75320713-75320735 CATAAAAAGAAGAGACAAAATGG - Intergenic
1055505248 9:76941655-76941677 CCTTATAACAAGAGACGCCAGGG + Intergenic
1055696091 9:78885985-78886007 ACTTACAAGAAGAAACTCAATGG - Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1057168768 9:92948272-92948294 CCTTATGAGAAGTGACACTTAGG - Intronic
1057317715 9:93980430-93980452 CCACATAAGGAGAGACACACGGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057614742 9:96579285-96579307 CCTTATAAGATGAGAGATACAGG + Intronic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059476570 9:114552244-114552266 CCTTTTAAAAATAGAAACAATGG + Intergenic
1061313478 9:129779087-129779109 CCTTATAAAAAGAGACACCAGGG - Intergenic
1061390737 9:130315847-130315869 CCTTTTAAGAAGAGATGCCAGGG - Intronic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1185713316 X:2321533-2321555 CCTTGTAAGAAGAGACACCAGGG + Intronic
1185720393 X:2376690-2376712 CCTTATAAGAAAAGGAACATTGG + Intronic
1185847013 X:3447191-3447213 CCTTATAAGAAGACACTCTGGGG + Intergenic
1185872358 X:3674530-3674552 TCTTATAAGAAGAGACACACAGG + Intronic
1185936258 X:4260786-4260808 CCTTATAAGAAGAGACACAGGGG - Intergenic
1187124120 X:16437602-16437624 TCTTATAAGAAAAGACACTGGGG - Intergenic
1187229698 X:17408998-17409020 CTTTATCAGAAGAGACACCAGGG - Intronic
1187632088 X:21184381-21184403 TCTTAAAAGAAGACACACAATGG - Intergenic
1188189104 X:27152409-27152431 CCATATAAGAAGAGACACCAGGG - Intergenic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1190243165 X:48673539-48673561 CCTTATAAGAAGAGACGTGATGG - Intergenic
1191152637 X:57236633-57236655 TCTTAAAAGAAGACATACAAAGG - Intergenic
1192785889 X:74334948-74334970 CCTTATAAAAAGAGAGATATTGG - Intergenic
1193194594 X:78617030-78617052 AACTATAAGAAGAGACAAAAAGG - Intergenic
1193441714 X:81548798-81548820 CATTATTAGAAAAGACAGAAAGG - Intergenic
1193596184 X:83448906-83448928 AACTATAAGAAGAGACAAAAAGG - Intergenic
1193873424 X:86830505-86830527 CCTTGTAAGCAGACACATAAAGG + Intronic
1193982068 X:88193889-88193911 TCTTAAAAGAAGACATACAAAGG + Intergenic
1194458318 X:94132492-94132514 CCTTATAAGAAGAGGCAATTAGG + Intergenic
1194981483 X:100445497-100445519 CCTCAGAGGAAGAGACACCAGGG + Intergenic
1195558546 X:106255978-106256000 AAGTATAAGAAGAGACAAAACGG - Intergenic
1195868787 X:109463746-109463768 ACTCTTAAAAAGAGACACAAGGG + Intronic
1196374832 X:115021680-115021702 TTTTATAATAAAAGACACAACGG + Intergenic
1197691735 X:129508301-129508323 CATTAACAGAAGAGAAACAAAGG + Intronic
1197786940 X:130207814-130207836 ACTTACAAGAAGAGGCACAAGGG - Intronic
1198610030 X:138388343-138388365 CCTAAAAAGAAGACATACAAGGG + Intergenic
1198685319 X:139222583-139222605 CCTTAGAAGTGGAGACGCAATGG + Intronic
1198948103 X:142038180-142038202 CCTTACAAGAAGTGAGAGAAAGG - Intergenic
1199022762 X:142901711-142901733 CCTTAAAAGAAAAGATACATGGG + Intergenic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1199130163 X:144175743-144175765 CCTTATAAGAAGATAAACCACGG - Intergenic
1200791548 Y:7304151-7304173 TCTTATAAGAAGAGACACACAGG - Intergenic
1201223418 Y:11792680-11792702 CCTTATAAGGAGAGACAGCAAGG + Intergenic
1201720611 Y:17093013-17093035 CCTTATAAGAAGAGACACAGGGG - Intergenic