ID: 1124729310 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:32182680-32182702 |
Sequence | GTGGTGGGATGGCCTGCGAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124729307_1124729310 | -8 | Left | 1124729307 | 15:32182665-32182687 | CCAGGTGGGACGAGTGTGGTGGG | No data | ||
Right | 1124729310 | 15:32182680-32182702 | GTGGTGGGATGGCCTGCGAGAGG | No data | ||||
1124729301_1124729310 | 23 | Left | 1124729301 | 15:32182634-32182656 | CCGGTGAACAGTAATGGAACATT | No data | ||
Right | 1124729310 | 15:32182680-32182702 | GTGGTGGGATGGCCTGCGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124729310 | Original CRISPR | GTGGTGGGATGGCCTGCGAG AGG | Intergenic | ||
No off target data available for this crispr |