ID: 1124729310

View in Genome Browser
Species Human (GRCh38)
Location 15:32182680-32182702
Sequence GTGGTGGGATGGCCTGCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124729307_1124729310 -8 Left 1124729307 15:32182665-32182687 CCAGGTGGGACGAGTGTGGTGGG No data
Right 1124729310 15:32182680-32182702 GTGGTGGGATGGCCTGCGAGAGG No data
1124729301_1124729310 23 Left 1124729301 15:32182634-32182656 CCGGTGAACAGTAATGGAACATT No data
Right 1124729310 15:32182680-32182702 GTGGTGGGATGGCCTGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124729310 Original CRISPR GTGGTGGGATGGCCTGCGAG AGG Intergenic
No off target data available for this crispr