ID: 1124734014

View in Genome Browser
Species Human (GRCh38)
Location 15:32227002-32227024
Sequence GGCCCCTAGAAACTTCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124734009_1124734014 14 Left 1124734009 15:32226965-32226987 CCTTACAAGGGATATTTTGACAC No data
Right 1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG No data
1124734011_1124734014 -10 Left 1124734011 15:32226989-32227011 CCCCACAGCACTAGGCCCCTAGA No data
Right 1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124734014 Original CRISPR GGCCCCTAGAAACTTCACTG AGG Intergenic
No off target data available for this crispr