ID: 1124734142

View in Genome Browser
Species Human (GRCh38)
Location 15:32228308-32228330
Sequence TAGGCCCACCTGGATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124734139_1124734142 -10 Left 1124734139 15:32228295-32228317 CCACTGTGTCAGCTAGGCCCACC No data
Right 1124734142 15:32228308-32228330 TAGGCCCACCTGGATTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124734142 Original CRISPR TAGGCCCACCTGGATTTTGG TGG Intergenic
No off target data available for this crispr