ID: 1124743241

View in Genome Browser
Species Human (GRCh38)
Location 15:32315679-32315701
Sequence CCCCGCGCGCGTCCATGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124743231_1124743241 -5 Left 1124743231 15:32315661-32315683 CCCCGGGCCGCCCGCCGCCCCCG No data
Right 1124743241 15:32315679-32315701 CCCCGCGCGCGTCCATGGCGAGG No data
1124743232_1124743241 -6 Left 1124743232 15:32315662-32315684 CCCGGGCCGCCCGCCGCCCCCGC No data
Right 1124743241 15:32315679-32315701 CCCCGCGCGCGTCCATGGCGAGG No data
1124743233_1124743241 -7 Left 1124743233 15:32315663-32315685 CCGGGCCGCCCGCCGCCCCCGCG No data
Right 1124743241 15:32315679-32315701 CCCCGCGCGCGTCCATGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124743241 Original CRISPR CCCCGCGCGCGTCCATGGCG AGG Intergenic
No off target data available for this crispr