ID: 1124743612

View in Genome Browser
Species Human (GRCh38)
Location 15:32319391-32319413
Sequence GTCAATACTCATATTAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124743612_1124743620 23 Left 1124743612 15:32319391-32319413 CCCTACCTAATATGAGTATTGAC No data
Right 1124743620 15:32319437-32319459 GGCTTGGGAGGAATCAGACATGG No data
1124743612_1124743616 2 Left 1124743612 15:32319391-32319413 CCCTACCTAATATGAGTATTGAC No data
Right 1124743616 15:32319416-32319438 TACAATAGATAACAAAGAATGGG No data
1124743612_1124743618 8 Left 1124743612 15:32319391-32319413 CCCTACCTAATATGAGTATTGAC No data
Right 1124743618 15:32319422-32319444 AGATAACAAAGAATGGGCTTGGG No data
1124743612_1124743617 7 Left 1124743612 15:32319391-32319413 CCCTACCTAATATGAGTATTGAC No data
Right 1124743617 15:32319421-32319443 TAGATAACAAAGAATGGGCTTGG No data
1124743612_1124743615 1 Left 1124743612 15:32319391-32319413 CCCTACCTAATATGAGTATTGAC No data
Right 1124743615 15:32319415-32319437 TTACAATAGATAACAAAGAATGG No data
1124743612_1124743619 11 Left 1124743612 15:32319391-32319413 CCCTACCTAATATGAGTATTGAC No data
Right 1124743619 15:32319425-32319447 TAACAAAGAATGGGCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124743612 Original CRISPR GTCAATACTCATATTAGGTA GGG (reversed) Intergenic
No off target data available for this crispr