ID: 1124746580

View in Genome Browser
Species Human (GRCh38)
Location 15:32345814-32345836
Sequence CCGCGGGCTGCCGGAGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124746572_1124746580 3 Left 1124746572 15:32345788-32345810 CCTCTGGGACAGACTGAGGCAGG No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data
1124746571_1124746580 4 Left 1124746571 15:32345787-32345809 CCCTCTGGGACAGACTGAGGCAG No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data
1124746568_1124746580 15 Left 1124746568 15:32345776-32345798 CCTTGACCTCACCCTCTGGGACA No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data
1124746563_1124746580 27 Left 1124746563 15:32345764-32345786 CCCTGGCACCAGCCTTGACCTCA No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data
1124746569_1124746580 9 Left 1124746569 15:32345782-32345804 CCTCACCCTCTGGGACAGACTGA No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data
1124746564_1124746580 26 Left 1124746564 15:32345765-32345787 CCTGGCACCAGCCTTGACCTCAC No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data
1124746565_1124746580 19 Left 1124746565 15:32345772-32345794 CCAGCCTTGACCTCACCCTCTGG No data
Right 1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124746580 Original CRISPR CCGCGGGCTGCCGGAGCCCT CGG Intergenic
No off target data available for this crispr