ID: 1124750531

View in Genome Browser
Species Human (GRCh38)
Location 15:32368685-32368707
Sequence AAGGAGAAAACAAATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750531_1124750537 -10 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750537 15:32368698-32368720 TTTTCTCCTTCTCAAGGCTGAGG No data
1124750531_1124750545 25 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750545 15:32368733-32368755 GGTTCTGAAGTACCAGAGGGTGG No data
1124750531_1124750540 4 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750540 15:32368712-32368734 AGGCTGAGGATCCAGCTCCAGGG No data
1124750531_1124750544 22 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750544 15:32368730-32368752 CAGGGTTCTGAAGTACCAGAGGG No data
1124750531_1124750543 21 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750543 15:32368729-32368751 CCAGGGTTCTGAAGTACCAGAGG No data
1124750531_1124750539 3 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750539 15:32368711-32368733 AAGGCTGAGGATCCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750531 Original CRISPR AAGGAGAAAACAAATGAGGG GGG (reversed) Intergenic
No off target data available for this crispr