ID: 1124750537

View in Genome Browser
Species Human (GRCh38)
Location 15:32368698-32368720
Sequence TTTTCTCCTTCTCAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750531_1124750537 -10 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750537 15:32368698-32368720 TTTTCTCCTTCTCAAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750537 Original CRISPR TTTTCTCCTTCTCAAGGCTG AGG Intergenic
No off target data available for this crispr